ID: 980194412

View in Genome Browser
Species Human (GRCh38)
Location 4:129569823-129569845
Sequence TGCCACGTGATGTCAGGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980194412_980194416 6 Left 980194412 4:129569823-129569845 CCACTTCCTGACATCACGTGGCA No data
Right 980194416 4:129569852-129569874 GCCAGAACTTACCCAATGGGAGG No data
980194412_980194415 3 Left 980194412 4:129569823-129569845 CCACTTCCTGACATCACGTGGCA No data
Right 980194415 4:129569849-129569871 AAAGCCAGAACTTACCCAATGGG No data
980194412_980194414 2 Left 980194412 4:129569823-129569845 CCACTTCCTGACATCACGTGGCA No data
Right 980194414 4:129569848-129569870 CAAAGCCAGAACTTACCCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980194412 Original CRISPR TGCCACGTGATGTCAGGAAG TGG (reversed) Intergenic
No off target data available for this crispr