ID: 980202464

View in Genome Browser
Species Human (GRCh38)
Location 4:129674304-129674326
Sequence CCAGGAACAAATCTGGGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980202464_980202473 20 Left 980202464 4:129674304-129674326 CCACAGCCCAGATTTGTTCCTGG No data
Right 980202473 4:129674347-129674369 GGGCATGCTGACTTCAATCTGGG No data
980202464_980202469 -1 Left 980202464 4:129674304-129674326 CCACAGCCCAGATTTGTTCCTGG No data
Right 980202469 4:129674326-129674348 GAATATGTAGAGCCAAAAAGCGG No data
980202464_980202472 19 Left 980202464 4:129674304-129674326 CCACAGCCCAGATTTGTTCCTGG No data
Right 980202472 4:129674346-129674368 CGGGCATGCTGACTTCAATCTGG No data
980202464_980202470 0 Left 980202464 4:129674304-129674326 CCACAGCCCAGATTTGTTCCTGG No data
Right 980202470 4:129674327-129674349 AATATGTAGAGCCAAAAAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980202464 Original CRISPR CCAGGAACAAATCTGGGCTG TGG (reversed) Intergenic