ID: 980202466

View in Genome Browser
Species Human (GRCh38)
Location 4:129674310-129674332
Sequence CATATTCCAGGAACAAATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980202466_980202473 14 Left 980202466 4:129674310-129674332 CCCAGATTTGTTCCTGGAATATG No data
Right 980202473 4:129674347-129674369 GGGCATGCTGACTTCAATCTGGG No data
980202466_980202472 13 Left 980202466 4:129674310-129674332 CCCAGATTTGTTCCTGGAATATG No data
Right 980202472 4:129674346-129674368 CGGGCATGCTGACTTCAATCTGG No data
980202466_980202470 -6 Left 980202466 4:129674310-129674332 CCCAGATTTGTTCCTGGAATATG No data
Right 980202470 4:129674327-129674349 AATATGTAGAGCCAAAAAGCGGG No data
980202466_980202469 -7 Left 980202466 4:129674310-129674332 CCCAGATTTGTTCCTGGAATATG No data
Right 980202469 4:129674326-129674348 GAATATGTAGAGCCAAAAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980202466 Original CRISPR CATATTCCAGGAACAAATCT GGG (reversed) Intergenic