ID: 980202470

View in Genome Browser
Species Human (GRCh38)
Location 4:129674327-129674349
Sequence AATATGTAGAGCCAAAAAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980202467_980202470 -7 Left 980202467 4:129674311-129674333 CCAGATTTGTTCCTGGAATATGT No data
Right 980202470 4:129674327-129674349 AATATGTAGAGCCAAAAAGCGGG No data
980202466_980202470 -6 Left 980202466 4:129674310-129674332 CCCAGATTTGTTCCTGGAATATG No data
Right 980202470 4:129674327-129674349 AATATGTAGAGCCAAAAAGCGGG No data
980202464_980202470 0 Left 980202464 4:129674304-129674326 CCACAGCCCAGATTTGTTCCTGG No data
Right 980202470 4:129674327-129674349 AATATGTAGAGCCAAAAAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980202470 Original CRISPR AATATGTAGAGCCAAAAAGC GGG Intergenic