ID: 980203021

View in Genome Browser
Species Human (GRCh38)
Location 4:129679748-129679770
Sequence CAGTTCTGCCACTTAAAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980203021_980203022 -9 Left 980203021 4:129679748-129679770 CCAACTTTTAAGTGGCAGAACTG No data
Right 980203022 4:129679762-129679784 GCAGAACTGAGATTTAACCTAGG No data
980203021_980203024 30 Left 980203021 4:129679748-129679770 CCAACTTTTAAGTGGCAGAACTG No data
Right 980203024 4:129679801-129679823 GCAGAGATTCTGAATTCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980203021 Original CRISPR CAGTTCTGCCACTTAAAAGT TGG (reversed) Intergenic
No off target data available for this crispr