ID: 980212780

View in Genome Browser
Species Human (GRCh38)
Location 4:129811356-129811378
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980212771_980212780 17 Left 980212771 4:129811316-129811338 CCAAACTAGAATGTCTCTTAGTG No data
Right 980212780 4:129811356-129811378 CCATAGGGGATATGGCCATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr