ID: 980213840

View in Genome Browser
Species Human (GRCh38)
Location 4:129825340-129825362
Sequence CTTTTCTAGGTCATCATTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 225}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980213837_980213840 18 Left 980213837 4:129825299-129825321 CCATTTTCCTCTCTCTCAATAAT No data
Right 980213840 4:129825340-129825362 CTTTTCTAGGTCATCATTCTAGG 0: 1
1: 0
2: 1
3: 23
4: 225
980213838_980213840 11 Left 980213838 4:129825306-129825328 CCTCTCTCTCAATAATCAAACTA No data
Right 980213840 4:129825340-129825362 CTTTTCTAGGTCATCATTCTAGG 0: 1
1: 0
2: 1
3: 23
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980213840 Original CRISPR CTTTTCTAGGTCATCATTCT AGG Intergenic
902154382 1:14472381-14472403 CTATTCACGGTAATCATTCTGGG + Intergenic
905763053 1:40576650-40576672 CACTTCTAGGTATTCATTCTAGG + Intergenic
906283555 1:44570327-44570349 CTTTTCTATGACAGTATTCTGGG + Intronic
906349683 1:45047613-45047635 TTTATCTAGGACATCACTCTAGG - Intronic
908030123 1:59990217-59990239 CTTCTCCTGGTCATTATTCTAGG - Intronic
908856124 1:68431675-68431697 CTTTTTTAGGTCAACATGCAGGG + Intronic
911249540 1:95559325-95559347 TTTTTGTAGGTCATAAATCTGGG + Intergenic
911276661 1:95868647-95868669 CTTTTCCAGGTCTTCATTCTAGG + Intergenic
911369564 1:96980326-96980348 CTTCTCTGGCTAATCATTCTGGG + Intergenic
912016610 1:105045393-105045415 CTTTTCTTGGTGCACATTCTCGG - Intergenic
915548806 1:156619754-156619776 CTCTTCCAGGTCATCATTCCTGG + Intronic
915816169 1:158967989-158968011 ATTTTCTAGGTCATCTTCCAGGG - Intronic
917338783 1:173953054-173953076 CTTTTCTGAGTCATCATTATTGG + Intronic
917491399 1:175501538-175501560 TTTTTCTAGGTCAAAAGTCTGGG - Intronic
917820899 1:178762935-178762957 ATTTCCTAGGTTATCATTCCAGG + Intronic
918341711 1:183573191-183573213 CTTGCCTAGGTAATCCTTCTTGG + Exonic
919260461 1:195186853-195186875 TTTTTCTAGCTCCTGATTCTTGG - Intergenic
921748344 1:218763753-218763775 CCTTTGTAGGTGGTCATTCTAGG + Intergenic
922923856 1:229331048-229331070 CTTTTCCAGGTCATCCTTAGTGG - Intronic
923362412 1:233224651-233224673 TTTTTCTAGGTCAGTATTTTGGG + Intronic
1064517514 10:16167355-16167377 CCTTTCTAGGACATCATTGAAGG - Intergenic
1064560121 10:16587724-16587746 CTTTTATACCTCATCATTCTGGG - Intergenic
1065910169 10:30296177-30296199 CTTTTCTAAGTCATGATTTTGGG - Intergenic
1066459522 10:35601025-35601047 CTTTGCTGGTACATCATTCTTGG + Intergenic
1067228634 10:44391691-44391713 CTTTTCTTGTTCTTCTTTCTGGG + Intergenic
1067740073 10:48888809-48888831 CTGTTCTTGGACATTATTCTTGG - Intronic
1068274723 10:54779126-54779148 CTTTTCTAAGGCAAGATTCTAGG + Intronic
1069206933 10:65701313-65701335 TTTCTCTAGGTCAGCAGTCTAGG + Intergenic
1071982612 10:91018962-91018984 CTATTATTGGTCATCATTCTGGG - Intergenic
1072807086 10:98430451-98430473 GTTTTCTAAGTCACAATTCTGGG - Intronic
1075293397 10:121250839-121250861 CATTTCTAGATCAACATTCAAGG + Intergenic
1076069120 10:127472044-127472066 CTTTTCTAGGTTCTAATTCTTGG - Intergenic
1077931440 11:6737291-6737313 CTCTTCTAGGTCCTCAGTCATGG - Intergenic
1078264914 11:9747878-9747900 CTTTTCTAGTTCAGCCCTCTTGG - Exonic
1079194197 11:18310783-18310805 TTTTTGTAGGTGATCATGCTGGG - Exonic
1081046227 11:38277666-38277688 GTTTTCTAGGTTATTATCCTTGG + Intergenic
1085238901 11:75035665-75035687 GTTTTCTATGGAATCATTCTGGG - Intergenic
1086503051 11:87473116-87473138 CTTTTCAACCTCATCATTCATGG - Intergenic
1086563282 11:88193835-88193857 ATTTTCTAGGTTATCTTTCAGGG + Intergenic
1087110910 11:94466201-94466223 CTTTTTTAGGTTAGCATTCAGGG - Intronic
1089017510 11:115178667-115178689 CTGTGCTTGCTCATCATTCTGGG - Exonic
1089396396 11:118138799-118138821 CTTTTCCTGCTCATCTTTCTTGG - Intronic
1092559382 12:9594663-9594685 CTTTTCAAATTTATCATTCTTGG - Exonic
1093654875 12:21683220-21683242 ATTTTCTTGCTCATCATTTTTGG + Intronic
1096601485 12:52732940-52732962 TTTTTCCAGGTCCTCACTCTTGG + Intergenic
1097127684 12:56788468-56788490 TTTTTCTAATTGATCATTCTTGG + Intergenic
1097339409 12:58419987-58420009 CTTTTATATGGCAACATTCTAGG + Intergenic
1097706411 12:62873450-62873472 ATTTTGTAGGTGAACATTCTCGG - Intronic
1097991507 12:65839895-65839917 TGTCTCTAGGTCATCCTTCTGGG + Intronic
1099103777 12:78476472-78476494 TTTTCTTAGGTCATCAATCTAGG + Intergenic
1099504164 12:83451427-83451449 ATTGTCTAGTTCAGCATTCTTGG - Intergenic
1102733657 12:115137840-115137862 TCTTTCTAGGTTATCAGTCTTGG + Intergenic
1103237383 12:119384773-119384795 CTTTTCTAGGGCATTAGGCTTGG - Intronic
1106104300 13:26720946-26720968 TTTTTCTAAGTCATTATTTTTGG - Intergenic
1109081730 13:57911150-57911172 TTGTTCTAGGTCAGCATTGTTGG + Intergenic
1109131520 13:58592381-58592403 CTTTTTTAGGTAATAAGTCTAGG - Intergenic
1114353224 14:21877849-21877871 CTTTTCTAGGTCATCCTTGGGGG + Intergenic
1116101848 14:40448233-40448255 CTTTTCTCGGTAATTCTTCTTGG - Intergenic
1117965211 14:61200216-61200238 CTTATCCAGGTTTTCATTCTGGG - Intronic
1118339535 14:64882520-64882542 GTTATCAAGGTCATCATTGTGGG + Intergenic
1118554890 14:67007264-67007286 TTTTTCTAAGTCATGTTTCTGGG + Intronic
1122764719 14:104058928-104058950 CTTTTATAGGTCATGGTTTTTGG + Intergenic
1123765776 15:23477370-23477392 CTTTTCTAGATAAACATTCGAGG - Intergenic
1124112382 15:26804072-26804094 CATTACTAGGACATCTTTCTGGG + Intronic
1126168108 15:45670956-45670978 CTTTGCTAGGTCAACACTGTGGG - Intronic
1126926852 15:53598421-53598443 CATCTCTAGGTCACCACTCTCGG - Intronic
1132362489 15:101228604-101228626 CTTTTAAAGGACATCTTTCTTGG - Intronic
1133015917 16:2940177-2940199 CTTTTGTGGGTCAACATTATGGG + Intronic
1135518167 16:23152474-23152496 CTTTTTTAGGTCATGTTCCTGGG - Intergenic
1137796276 16:51222939-51222961 CTTTTCTTTGTCATCTGTCTTGG + Intergenic
1139258470 16:65566902-65566924 CTTTTCAAGGAAATAATTCTTGG - Intergenic
1146121468 17:30199521-30199543 CTTTTCTATTTTCTCATTCTGGG + Intronic
1146982369 17:37176289-37176311 CTCTACCAGGTCATCATTGTGGG - Intronic
1148421998 17:47556088-47556110 TTTTTTTAATTCATCATTCTTGG + Intronic
1151136462 17:71950505-71950527 CTTTTTTAAGTCCTCATCCTTGG + Intergenic
1151402476 17:73864900-73864922 CTTTTCAAGGGCATCGTTCCAGG + Intergenic
1151525938 17:74668009-74668031 CTTATCTTGGTGAGCATTCTAGG - Intergenic
1155582633 18:27327248-27327270 CTTTTCTTGATCAAGATTCTTGG - Intergenic
1155924251 18:31637495-31637517 ATTTTCAAAGTCATCTTTCTTGG - Intronic
1156494933 18:37519426-37519448 CTTCTGCAGGTCATCTTTCTTGG + Intronic
1157310558 18:46549601-46549623 CTTTTCTGTCTCAACATTCTGGG + Intronic
1158933919 18:62347324-62347346 CTTTTCCTGATCAGCATTCTTGG - Intronic
1159084659 18:63774966-63774988 CTATTTTAGGTCATTATGCTAGG + Intronic
1159560953 18:69993546-69993568 CTTTTTTAGTTGATCATTTTTGG + Intergenic
1163224967 19:15953477-15953499 TTTTTCTATCCCATCATTCTTGG + Intergenic
1165240946 19:34466871-34466893 CTTTCCTAGGTCTTCACTGTAGG - Exonic
926514755 2:13828803-13828825 CATTTATAGTTCATAATTCTTGG + Intergenic
926534816 2:14098809-14098831 CTCTTCTAGTCAATCATTCTTGG + Intergenic
927123216 2:19988614-19988636 CTTATCTAGGTCTTCAATCTAGG + Intronic
929269766 2:39960380-39960402 CCTTTCTAGGACATCCTTCAAGG - Intergenic
929310945 2:40423547-40423569 CTTTTCTTAGTCATCATTCAAGG - Intronic
931161621 2:59698522-59698544 CTTCTCCAGGACATCAGTCTGGG - Intergenic
933636754 2:84716818-84716840 CTTTTCAATGCCATCAATCTAGG - Intronic
934107981 2:88713701-88713723 TTTTTCTGGTTCATCTTTCTGGG + Intronic
934982989 2:98862076-98862098 CTTTTCTTGTTTCTCATTCTCGG + Intronic
935381417 2:102454643-102454665 CATTTCTAGGTTAAAATTCTAGG + Intergenic
937069667 2:119053610-119053632 CTTTTCTTGGTCGTCCTTTTGGG + Intergenic
938032964 2:128011229-128011251 CTTTTCTAGGTAATCGTTCAGGG + Intronic
938384400 2:130854084-130854106 CTTTTATTGGTCATGTTTCTTGG - Intronic
938917266 2:135954901-135954923 CTTTTATTTCTCATCATTCTAGG + Intronic
939156203 2:138527200-138527222 CTTTTTTCAGTAATCATTCTTGG + Intronic
939808676 2:146806084-146806106 CTTTTCAAGGTCTACATTATGGG + Intergenic
940404453 2:153284491-153284513 CTGATCTTGGTCCTCATTCTGGG + Intergenic
942068590 2:172294951-172294973 CCTTTCTCCGTCACCATTCTTGG + Intergenic
942758411 2:179369109-179369131 TATTTCTAGGTCATGATGCTGGG - Intergenic
943609704 2:190017914-190017936 CTTTTCTGGGTAAATATTCTTGG + Intronic
944468084 2:200023920-200023942 CTTTTCTAGGAAATAATGCTAGG + Intergenic
944896617 2:204171999-204172021 CTGGTCTTGGTCATCCTTCTGGG + Intergenic
948327307 2:237135754-237135776 CTTTTTTGAGTCTTCATTCTTGG - Intergenic
1169876316 20:10300926-10300948 ATTTTTTAGTTCATTATTCTGGG - Intronic
1169930736 20:10829935-10829957 CTTCTCATGGTCTTCATTCTGGG + Intergenic
1170995830 20:21357335-21357357 TTTTTCTAGGTAATATTTCTAGG + Intronic
1171091215 20:22287356-22287378 TTTTCCTAGGTCTTCCTTCTTGG + Intergenic
1173079444 20:39851671-39851693 CTTTTCTAAGTCACCCCTCTTGG + Intergenic
1173305615 20:41845330-41845352 ATTTTCTGGGTATTCATTCTTGG + Intergenic
1174349263 20:49955405-49955427 CTTTTCTCAGTGAGCATTCTTGG + Intergenic
1174458454 20:50666065-50666087 CCTTCCTTGGTCTTCATTCTGGG - Intronic
1176975197 21:15312863-15312885 TTTTTGAAGGTCATCTTTCTTGG - Intergenic
1177437600 21:21076358-21076380 CTTTGCTAGGTAATTATTTTGGG + Intronic
1178196424 21:30349833-30349855 CTTCTCTTGTTCATCCTTCTAGG + Intronic
1179605326 21:42512554-42512576 CTTTTCTAGCTCTCCATTCCCGG - Intronic
1180696641 22:17755367-17755389 CTTCTCTGGGTCACCAATCTAGG - Intronic
949616963 3:5764439-5764461 TTTTTCTGTTTCATCATTCTTGG - Intergenic
950799922 3:15542339-15542361 CTTTTCAAGATCATCATCCCTGG + Intergenic
950823898 3:15794397-15794419 CATTTCTAGGTCATCTGTTTTGG + Intronic
951290272 3:20866169-20866191 TTTTTTTAGTTGATCATTCTTGG + Intergenic
951312567 3:21146406-21146428 TTTTTCTAGTTCATCCTTCAAGG + Intergenic
951834632 3:26968573-26968595 TTGTTCTTGGTCACCATTCTGGG - Intergenic
954204351 3:49047100-49047122 CTTCTCTAGTTCAGCATTCTTGG + Exonic
955178287 3:56639307-56639329 CTTTTCTAGCTAAACATTTTTGG - Intronic
955317790 3:57953255-57953277 CTTTCCTAGCTCCTCATCCTGGG + Intergenic
955478389 3:59363158-59363180 GTTTTCTAGGTGATTATTATAGG + Intergenic
957843624 3:85701741-85701763 CTTTTCTATGGCCTCATTCTGGG - Intronic
959176030 3:102911914-102911936 CTTTTCTACTTCATCATTGTTGG - Intergenic
959595060 3:108120692-108120714 CATTTCTATGTCAGCATTTTGGG + Intergenic
960324844 3:116283149-116283171 CTTTTCTAAATCATTTTTCTGGG - Intronic
960764983 3:121116498-121116520 CTTTTCTTGTTCTTCATACTTGG + Intronic
961939775 3:130624952-130624974 CTTTTCTAGGGCCACATGCTTGG - Intronic
962109354 3:132427622-132427644 CTTTTGAAGGTGAACATTCTAGG + Intronic
962159525 3:132984235-132984257 CATTTTGGGGTCATCATTCTTGG - Intergenic
962732656 3:138298226-138298248 CTTTTCTAGTTCATAAATTTTGG - Intronic
965121397 3:164562012-164562034 CATTTCTAAGTGAGCATTCTAGG + Intergenic
965505122 3:169506900-169506922 CTTTTCTAAGTCATGATGGTTGG + Intronic
965942733 3:174204682-174204704 CTTTTCTAGGGCATTAGTCACGG - Intronic
966516591 3:180828064-180828086 CTTTTCTGGGTCCTCCTGCTGGG + Intronic
967435551 3:189441872-189441894 GTTTTTTAGGTCATTATACTAGG - Intergenic
970994193 4:22247040-22247062 CTTTTATAGTTCAGTATTCTGGG + Intergenic
971926319 4:33013629-33013651 CTTTTCTATGTATTCCTTCTAGG + Intergenic
972929583 4:44055084-44055106 CTTTTCTCGGATATCACTCTTGG - Intergenic
972947996 4:44281930-44281952 CTCATTTAGGTCATCATTTTGGG - Intronic
974424215 4:61719994-61720016 CTTTTCTTGGACATCATTTAAGG - Intronic
976770644 4:88648665-88648687 ATTTTGTTGGTCATTATTCTGGG + Intronic
978221469 4:106280500-106280522 CTCTACTAGGACATCAGTCTGGG - Intronic
979282621 4:118884726-118884748 CTTTTCTATGTCTTTATTCTGGG + Intronic
979405083 4:120299773-120299795 CTCTACTAGGTAAACATTCTAGG - Intergenic
980213840 4:129825340-129825362 CTTTTCTAGGTCATCATTCTAGG + Intergenic
980507545 4:133742393-133742415 ATTTTCTAGGTTATCTTTCAGGG + Intergenic
981791899 4:148547258-148547280 TTTTTCTAGATTCTCATTCTGGG + Intergenic
983069173 4:163248991-163249013 CTTTTATATTTCATCAGTCTTGG - Intergenic
983455767 4:167962249-167962271 GTTTTCCAGGACATGATTCTGGG - Intergenic
983537163 4:168870040-168870062 CTTTTCTCTGCCTTCATTCTTGG - Intronic
985438750 4:189962431-189962453 TTTTTCTATGTCATAAATCTAGG - Intronic
985811794 5:2095413-2095435 CATAGCTAGGTCATCATACTTGG - Intergenic
986535907 5:8786815-8786837 GTTTTCTAAGCCAGCATTCTAGG + Intergenic
989633660 5:43512011-43512033 TTTTTTTAGTTGATCATTCTTGG - Intronic
989774426 5:45186101-45186123 CTATTTTAGGTTCTCATTCTTGG - Intergenic
990675037 5:58174595-58174617 CTTGTCTAGGACATCATCTTTGG + Intergenic
990991584 5:61689636-61689658 TTATTCTAGGTCATCATTAAGGG - Intronic
991465654 5:66909655-66909677 CTTTTTGAGGTCAACATGCTTGG + Intronic
991516064 5:67437000-67437022 TTATTCTAGGTCATTATTTTAGG - Intergenic
993462170 5:88196475-88196497 ATTTTCTAGGTAATCATTCCTGG - Exonic
993563511 5:89443092-89443114 CTTTTCTAGCTGACCAATCTTGG - Intergenic
995038515 5:107562409-107562431 TTTTTCTAAATCAGCATTCTAGG + Intronic
995371656 5:111425592-111425614 CTTTTCTTTCTCATCATTCCTGG - Intronic
995741070 5:115356177-115356199 CTATTATATTTCATCATTCTGGG - Intergenic
996798720 5:127378812-127378834 CTTTACTAGGTCTTCTGTCTGGG - Intronic
998726348 5:145019786-145019808 CTATTTTAACTCATCATTCTTGG + Intergenic
999017863 5:148128034-148128056 CTTTTCTGGGTCATCAGCCTAGG - Intronic
999712962 5:154334641-154334663 CTTTTGTACCTCATCATTCCGGG - Intronic
1000577287 5:162989991-162990013 CATTTCTGGGTAATCATTTTGGG + Intergenic
1000644762 5:163747817-163747839 CTCTTCTAGGATATCATTCAGGG - Intergenic
1000692076 5:164336609-164336631 CTTTTCTGTGTATTCATTCTGGG + Intergenic
1006249968 6:32775150-32775172 GTTTTCTAGGTCAGAAGTCTAGG + Intergenic
1006794443 6:36722631-36722653 CTCTTCCATGTCATCTTTCTGGG + Exonic
1006967638 6:38004924-38004946 ATTTTCTAGTTCAACATTTTGGG - Intronic
1008422190 6:51314360-51314382 CTTTGCTAAGTCTTCATTTTTGG - Intergenic
1008889092 6:56464743-56464765 TTTTTCTAGTTCATCATCATGGG - Intronic
1009008674 6:57817138-57817160 CTATTCTAGTCCATCAATCTGGG + Intergenic
1010300500 6:74254527-74254549 TTTTTTTAGTTGATCATTCTTGG + Intergenic
1012182683 6:96174843-96174865 GTTTTCTAGGTCATCAGTTTAGG - Intronic
1013386621 6:109638232-109638254 CTGTTCTAGGTCATCAATGAAGG - Intronic
1014035123 6:116758088-116758110 CTTTTCAAGGTTTTCATTCCAGG - Intronic
1016210525 6:141527884-141527906 CTTTTCTTGTTCCTCTTTCTCGG + Intergenic
1017810024 6:157977834-157977856 CTTTTCTGAGTCCTGATTCTTGG + Intergenic
1018519851 6:164635711-164635733 CTTTTCTATGTCACCATCCATGG + Intergenic
1019222901 6:170488693-170488715 ATTTTCTGGGTCATATTTCTGGG + Intergenic
1019847499 7:3520923-3520945 GTTTTGTAGGTCATAAGTCTAGG + Intronic
1020372113 7:7443602-7443624 CTTTTCCAGGTGGTCCTTCTGGG + Exonic
1020416722 7:7954658-7954680 CTTTTCTACCTCCTCATTCTTGG + Intronic
1021430551 7:20553857-20553879 CTTTTCTAGGTCACCATTTAGGG + Intergenic
1021481932 7:21127651-21127673 CAATTCTAGGTGGTCATTCTGGG + Intergenic
1021620382 7:22545243-22545265 CTTTGCAGGGTCTTCATTCTAGG - Intronic
1022021026 7:26399146-26399168 CAGTACTAGGTCATCTTTCTTGG - Intergenic
1023447789 7:40250094-40250116 CTTTTAAAGGTAATTATTCTTGG + Intronic
1024280985 7:47719700-47719722 CTATTCTAGGTCCCTATTCTGGG - Intronic
1026081185 7:67222659-67222681 CTTTTTTAGTTCATTATCCTTGG + Intronic
1026695900 7:72591352-72591374 CTTTTTTAGTTCATTATCCTTGG - Intronic
1027506675 7:79024378-79024400 ATTTCCTAGGTTATCATTCAGGG - Intronic
1028363693 7:90000704-90000726 AGTTTCTAGGTCATAATTTTTGG - Intergenic
1029020308 7:97358079-97358101 CTTTTTTGTGTCATCATTTTTGG - Intergenic
1031101488 7:117486269-117486291 CCTTTGTAGGTCATGATTCTGGG + Intronic
1032949590 7:136892382-136892404 CTTCTCTGGGTTATCATACTTGG + Intronic
1033000326 7:137496843-137496865 ATTTCCTAGGTTATCATTCAGGG - Intronic
1034095618 7:148405169-148405191 CTTTTCCAACTCAACATTCTAGG - Intronic
1034860473 7:154590897-154590919 CTTGTCGAGGCCATCATTATGGG - Intronic
1035155119 7:156906099-156906121 CTGTTCTAGGGCATGGTTCTGGG - Intergenic
1037107105 8:15122465-15122487 TTTTTGTAGGTCATCTTTCCAGG + Intronic
1038040508 8:23720316-23720338 CATTTCTAGGTCCTCTTACTTGG - Intergenic
1039585667 8:38705104-38705126 CTTTTCTTGGCCTTCATTGTGGG - Intergenic
1039689825 8:39851504-39851526 CTTTTCTGAGTCTTCATTGTGGG + Intergenic
1040995695 8:53399749-53399771 CTCTTCCAGGTGATCATTCAGGG + Intergenic
1041108590 8:54465498-54465520 CTTTTTCAGGTCAATATTCTTGG - Intergenic
1041477570 8:58282956-58282978 CTTTTCTATTTTATCAGTCTGGG + Intergenic
1043206984 8:77456931-77456953 CTTTTCTTGGTGACCATTCTAGG - Intergenic
1044533350 8:93332967-93332989 CTTTTCTTGGTCTTCTTTCTAGG - Intergenic
1047804274 8:128343070-128343092 CTTGTATAGGGCATTATTCTAGG + Intergenic
1048079191 8:131106470-131106492 CTTTTCTAAGTCCTCATTTTGGG + Intergenic
1048099123 8:131328469-131328491 CTTTTCAGGGTCTGCATTCTTGG - Intergenic
1048540234 8:135335357-135335379 CTTTTAGAAGTCCTCATTCTAGG - Intergenic
1048870131 8:138790463-138790485 CCTTTCTTGGTCAACACTCTGGG + Intronic
1050109747 9:2201981-2202003 CTCCTGTAGGTCATGATTCTCGG - Intergenic
1051254597 9:15200559-15200581 ATTTTCAGGGTCAGCATTCTAGG + Intronic
1057011454 9:91606047-91606069 CTTTTCTAGGATATAATTCCAGG - Intronic
1057846206 9:98526679-98526701 CTTGTGTTGGTCACCATTCTAGG - Intronic
1058204570 9:102087258-102087280 GGTTTCTAGGTCAAAATTCTAGG + Intergenic
1059332314 9:113543304-113543326 CTCTTCTAGGCCACCATTTTTGG - Intronic
1059626167 9:116068853-116068875 CCTTTCTATGTCTTCCTTCTGGG - Intergenic
1061562483 9:131414881-131414903 CTTCTGTTGGTCGTCATTCTGGG + Intronic
1062095823 9:134702681-134702703 CCTTTCTAGGAAATCATACTGGG + Intronic
1185801383 X:3014456-3014478 CTCTTCTAGGTCCTCAAGCTAGG - Intronic
1187359004 X:18606954-18606976 CTTTTCTAGGACCTCCTTTTTGG + Intronic
1188164404 X:26844265-26844287 CTTTTCTTTGTCATCATTTCAGG + Intergenic
1189395323 X:40617419-40617441 GTTTTGTAGGTCAGAATTCTGGG + Intergenic
1192151764 X:68717207-68717229 CTCTTCTGAGTCTTCATTCTGGG - Exonic
1192561363 X:72130143-72130165 CTCATCTAGGTCATCATCTTGGG + Exonic
1193432209 X:81421882-81421904 CTTTACTAATTCATAATTCTAGG + Intergenic
1194714178 X:97271588-97271610 ATTTTCTAGGTTACCATCCTGGG + Intronic
1196926358 X:120637218-120637240 ATTTTCTAGGTTATCTTTCAGGG + Intergenic
1197876141 X:131109304-131109326 ATTCTCTGGGACATCATTCTAGG - Intergenic
1198177002 X:134166428-134166450 CTTTCCAAGGTCATCAGTATGGG - Intergenic