ID: 980223451

View in Genome Browser
Species Human (GRCh38)
Location 4:129949272-129949294
Sequence CACACTGAATGATATACCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980223451_980223461 21 Left 980223451 4:129949272-129949294 CCCAAGGTATATCATTCAGTGTG No data
Right 980223461 4:129949316-129949338 ACTATAGGTAAGAGCTGGATGGG No data
980223451_980223460 20 Left 980223451 4:129949272-129949294 CCCAAGGTATATCATTCAGTGTG No data
Right 980223460 4:129949315-129949337 CACTATAGGTAAGAGCTGGATGG No data
980223451_980223462 22 Left 980223451 4:129949272-129949294 CCCAAGGTATATCATTCAGTGTG No data
Right 980223462 4:129949317-129949339 CTATAGGTAAGAGCTGGATGGGG No data
980223451_980223459 16 Left 980223451 4:129949272-129949294 CCCAAGGTATATCATTCAGTGTG No data
Right 980223459 4:129949311-129949333 CCTGCACTATAGGTAAGAGCTGG No data
980223451_980223455 6 Left 980223451 4:129949272-129949294 CCCAAGGTATATCATTCAGTGTG No data
Right 980223455 4:129949301-129949323 TGGATAAACCCCTGCACTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980223451 Original CRISPR CACACTGAATGATATACCTT GGG (reversed) Intergenic
No off target data available for this crispr