ID: 980223460

View in Genome Browser
Species Human (GRCh38)
Location 4:129949315-129949337
Sequence CACTATAGGTAAGAGCTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980223451_980223460 20 Left 980223451 4:129949272-129949294 CCCAAGGTATATCATTCAGTGTG No data
Right 980223460 4:129949315-129949337 CACTATAGGTAAGAGCTGGATGG No data
980223452_980223460 19 Left 980223452 4:129949273-129949295 CCAAGGTATATCATTCAGTGTGA No data
Right 980223460 4:129949315-129949337 CACTATAGGTAAGAGCTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980223460 Original CRISPR CACTATAGGTAAGAGCTGGA TGG Intergenic
No off target data available for this crispr