ID: 980224151

View in Genome Browser
Species Human (GRCh38)
Location 4:129959513-129959535
Sequence CATTTTGAACAAATGGTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980224151_980224161 29 Left 980224151 4:129959513-129959535 CCCAGCACCATTTGTTCAAAATG No data
Right 980224161 4:129959565-129959587 AGGAGAAATTGTAAGAAAAAAGG No data
980224151_980224160 9 Left 980224151 4:129959513-129959535 CCCAGCACCATTTGTTCAAAATG No data
Right 980224160 4:129959545-129959567 GAGAGATCGGTCAGGGTGGTAGG No data
980224151_980224157 2 Left 980224151 4:129959513-129959535 CCCAGCACCATTTGTTCAAAATG No data
Right 980224157 4:129959538-129959560 GTCCTGTGAGAGATCGGTCAGGG No data
980224151_980224156 1 Left 980224151 4:129959513-129959535 CCCAGCACCATTTGTTCAAAATG No data
Right 980224156 4:129959537-129959559 AGTCCTGTGAGAGATCGGTCAGG No data
980224151_980224159 5 Left 980224151 4:129959513-129959535 CCCAGCACCATTTGTTCAAAATG No data
Right 980224159 4:129959541-129959563 CTGTGAGAGATCGGTCAGGGTGG No data
980224151_980224155 -4 Left 980224151 4:129959513-129959535 CCCAGCACCATTTGTTCAAAATG No data
Right 980224155 4:129959532-129959554 AATGGAGTCCTGTGAGAGATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980224151 Original CRISPR CATTTTGAACAAATGGTGCT GGG (reversed) Intergenic
No off target data available for this crispr