ID: 980228852

View in Genome Browser
Species Human (GRCh38)
Location 4:130021897-130021919
Sequence TCGTGGATAAGGAGGGCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980228847_980228852 -8 Left 980228847 4:130021882-130021904 CCACCAATGCAGAACTCGTGGAT No data
Right 980228852 4:130021897-130021919 TCGTGGATAAGGAGGGCTGATGG No data
980228845_980228852 12 Left 980228845 4:130021862-130021884 CCATGTGAGGTTAGTTTTATCCA No data
Right 980228852 4:130021897-130021919 TCGTGGATAAGGAGGGCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980228852 Original CRISPR TCGTGGATAAGGAGGGCTGA TGG Intergenic
No off target data available for this crispr