ID: 980246959

View in Genome Browser
Species Human (GRCh38)
Location 4:130258575-130258597
Sequence CTTCCCTGCTTGAATTGTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980246954_980246959 -5 Left 980246954 4:130258557-130258579 CCTGTGACCTAGAAGCCCCTTCC No data
Right 980246959 4:130258575-130258597 CTTCCCTGCTTGAATTGTCCCGG No data
980246952_980246959 12 Left 980246952 4:130258540-130258562 CCTTTGTCTCTCACCTACCTGTG 0: 7
1: 9
2: 24
3: 48
4: 289
Right 980246959 4:130258575-130258597 CTTCCCTGCTTGAATTGTCCCGG No data
980246951_980246959 13 Left 980246951 4:130258539-130258561 CCCTTTGTCTCTCACCTACCTGT 0: 72
1: 146
2: 210
3: 360
4: 643
Right 980246959 4:130258575-130258597 CTTCCCTGCTTGAATTGTCCCGG No data
980246953_980246959 -1 Left 980246953 4:130258553-130258575 CCTACCTGTGACCTAGAAGCCCC No data
Right 980246959 4:130258575-130258597 CTTCCCTGCTTGAATTGTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980246959 Original CRISPR CTTCCCTGCTTGAATTGTCC CGG Intergenic
No off target data available for this crispr