ID: 980247496

View in Genome Browser
Species Human (GRCh38)
Location 4:130266729-130266751
Sequence GGTCATGTATGTTCACAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980247492_980247496 30 Left 980247492 4:130266676-130266698 CCTACGAGGTGGTCTCAGATGGA No data
Right 980247496 4:130266729-130266751 GGTCATGTATGTTCACAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980247496 Original CRISPR GGTCATGTATGTTCACAAAG AGG Intergenic
No off target data available for this crispr