ID: 980249268

View in Genome Browser
Species Human (GRCh38)
Location 4:130293055-130293077
Sequence GACTCAGAGAAATGAGAGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980249261_980249268 18 Left 980249261 4:130293014-130293036 CCCTATATTAACCTGCAAAGGAG No data
Right 980249268 4:130293055-130293077 GACTCAGAGAAATGAGAGTATGG No data
980249262_980249268 17 Left 980249262 4:130293015-130293037 CCTATATTAACCTGCAAAGGAGC No data
Right 980249268 4:130293055-130293077 GACTCAGAGAAATGAGAGTATGG No data
980249267_980249268 7 Left 980249267 4:130293025-130293047 CCTGCAAAGGAGCAGGGTAGGGA No data
Right 980249268 4:130293055-130293077 GACTCAGAGAAATGAGAGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980249268 Original CRISPR GACTCAGAGAAATGAGAGTA TGG Intergenic
No off target data available for this crispr