ID: 980252456

View in Genome Browser
Species Human (GRCh38)
Location 4:130335502-130335524
Sequence GACCAGTGCTTACCTGGTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980252456_980252461 0 Left 980252456 4:130335502-130335524 CCTGTACCAGGTAAGCACTGGTC No data
Right 980252461 4:130335525-130335547 CAGGGTGCTCTTATTATAGTAGG No data
980252456_980252462 8 Left 980252456 4:130335502-130335524 CCTGTACCAGGTAAGCACTGGTC No data
Right 980252462 4:130335533-130335555 TCTTATTATAGTAGGTAGTTAGG No data
980252456_980252464 27 Left 980252456 4:130335502-130335524 CCTGTACCAGGTAAGCACTGGTC No data
Right 980252464 4:130335552-130335574 TAGGCCAACATGAGCAGGAGTGG No data
980252456_980252463 22 Left 980252456 4:130335502-130335524 CCTGTACCAGGTAAGCACTGGTC No data
Right 980252463 4:130335547-130335569 GTAGTTAGGCCAACATGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980252456 Original CRISPR GACCAGTGCTTACCTGGTAC AGG (reversed) Intergenic
No off target data available for this crispr