ID: 980255786

View in Genome Browser
Species Human (GRCh38)
Location 4:130379458-130379480
Sequence CAGAGGAAACATCAGGGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980255779_980255786 12 Left 980255779 4:130379423-130379445 CCAGCAGAATTAAAGGGATCAAG No data
Right 980255786 4:130379458-130379480 CAGAGGAAACATCAGGGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980255786 Original CRISPR CAGAGGAAACATCAGGGTGG GGG Intergenic
No off target data available for this crispr