ID: 980262586

View in Genome Browser
Species Human (GRCh38)
Location 4:130471497-130471519
Sequence TAAGTATTCCATTTCTATAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980262586_980262587 -8 Left 980262586 4:130471497-130471519 CCGATATAGAAATGGAATACTTA No data
Right 980262587 4:130471512-130471534 AATACTTAGAACTAGTGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980262586 Original CRISPR TAAGTATTCCATTTCTATAT CGG (reversed) Intergenic
No off target data available for this crispr