ID: 980262598

View in Genome Browser
Species Human (GRCh38)
Location 4:130471593-130471615
Sequence GGGTGGACAAGATTTCCTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980262589_980262598 27 Left 980262589 4:130471543-130471565 CCAAAAGTTGCAGATCTGTGAAT No data
Right 980262598 4:130471593-130471615 GGGTGGACAAGATTTCCTAGGGG No data
980262588_980262598 28 Left 980262588 4:130471542-130471564 CCCAAAAGTTGCAGATCTGTGAA No data
Right 980262598 4:130471593-130471615 GGGTGGACAAGATTTCCTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980262598 Original CRISPR GGGTGGACAAGATTTCCTAG GGG Intergenic
No off target data available for this crispr