ID: 980263020

View in Genome Browser
Species Human (GRCh38)
Location 4:130478674-130478696
Sequence ACTGAAATCTTTAGCCACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980263020_980263023 1 Left 980263020 4:130478674-130478696 CCTCAGTGGCTAAAGATTTCAGT No data
Right 980263023 4:130478698-130478720 TCATCTGAGGAGCAGGCCACTGG No data
980263020_980263022 -6 Left 980263020 4:130478674-130478696 CCTCAGTGGCTAAAGATTTCAGT No data
Right 980263022 4:130478691-130478713 TTCAGTGTCATCTGAGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980263020 Original CRISPR ACTGAAATCTTTAGCCACTG AGG (reversed) Intergenic
No off target data available for this crispr