ID: 980274448

View in Genome Browser
Species Human (GRCh38)
Location 4:130631503-130631525
Sequence GAATTCTTCTGCACAGGTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980274448_980274453 8 Left 980274448 4:130631503-130631525 CCAATACCTGTGCAGAAGAATTC No data
Right 980274453 4:130631534-130631556 CTGTAGAAATACTCCCCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980274448 Original CRISPR GAATTCTTCTGCACAGGTAT TGG (reversed) Intergenic
No off target data available for this crispr