ID: 980274458

View in Genome Browser
Species Human (GRCh38)
Location 4:130631581-130631603
Sequence CTGTGTGAGGTATACATGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980274458_980274462 12 Left 980274458 4:130631581-130631603 CCTTACATGTATACCTCACACAG No data
Right 980274462 4:130631616-130631638 TGGAGTACAGTGTGAAGAGAGGG No data
980274458_980274460 -8 Left 980274458 4:130631581-130631603 CCTTACATGTATACCTCACACAG No data
Right 980274460 4:130631596-130631618 TCACACAGTTACTTCTTAAATGG No data
980274458_980274461 11 Left 980274458 4:130631581-130631603 CCTTACATGTATACCTCACACAG No data
Right 980274461 4:130631615-130631637 ATGGAGTACAGTGTGAAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980274458 Original CRISPR CTGTGTGAGGTATACATGTA AGG (reversed) Intergenic
No off target data available for this crispr