ID: 980275204

View in Genome Browser
Species Human (GRCh38)
Location 4:130642069-130642091
Sequence CTCAGTTTCTATGAGTAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980275204_980275207 23 Left 980275204 4:130642069-130642091 CCTACCTACTCATAGAAACTGAG No data
Right 980275207 4:130642115-130642137 ATGATTACATTTCAAAGAGATGG 0: 12
1: 86
2: 173
3: 250
4: 686

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980275204 Original CRISPR CTCAGTTTCTATGAGTAGGT AGG (reversed) Intergenic
No off target data available for this crispr