ID: 980275204 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:130642069-130642091 |
| Sequence | CTCAGTTTCTATGAGTAGGT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 980275204_980275207 | 23 | Left | 980275204 | 4:130642069-130642091 | CCTACCTACTCATAGAAACTGAG | No data | ||
| Right | 980275207 | 4:130642115-130642137 | ATGATTACATTTCAAAGAGATGG | 0: 12 1: 86 2: 173 3: 250 4: 686 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 980275204 | Original CRISPR | CTCAGTTTCTATGAGTAGGT AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||