ID: 980288116

View in Genome Browser
Species Human (GRCh38)
Location 4:130807206-130807228
Sequence TATTTGGATTTTTAACTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980288113_980288116 9 Left 980288113 4:130807174-130807196 CCATAAATCTTGAACAAATTTCC No data
Right 980288116 4:130807206-130807228 TATTTGGATTTTTAACTGCTAGG No data
980288112_980288116 10 Left 980288112 4:130807173-130807195 CCCATAAATCTTGAACAAATTTC No data
Right 980288116 4:130807206-130807228 TATTTGGATTTTTAACTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980288116 Original CRISPR TATTTGGATTTTTAACTGCT AGG Intergenic
No off target data available for this crispr