ID: 980288125

View in Genome Browser
Species Human (GRCh38)
Location 4:130807348-130807370
Sequence TATTTGGATTTTTAACTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980288121_980288125 21 Left 980288121 4:130807304-130807326 CCTTGAACTGTTTTGGATATTAG No data
Right 980288125 4:130807348-130807370 TATTTGGATTTTTAACTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980288125 Original CRISPR TATTTGGATTTTTAACTGCT AGG Intergenic
No off target data available for this crispr