ID: 980294135

View in Genome Browser
Species Human (GRCh38)
Location 4:130888405-130888427
Sequence CTGTGTAAGGACAAGTGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980294135_980294139 21 Left 980294135 4:130888405-130888427 CCAGGACACTTGTCCTTACACAG No data
Right 980294139 4:130888449-130888471 AAAAATGTTTTAATCTCAGGAGG No data
980294135_980294138 18 Left 980294135 4:130888405-130888427 CCAGGACACTTGTCCTTACACAG No data
Right 980294138 4:130888446-130888468 GACAAAAATGTTTTAATCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980294135 Original CRISPR CTGTGTAAGGACAAGTGTCC TGG (reversed) Intergenic
No off target data available for this crispr