ID: 980294138

View in Genome Browser
Species Human (GRCh38)
Location 4:130888446-130888468
Sequence GACAAAAATGTTTTAATCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980294136_980294138 5 Left 980294136 4:130888418-130888440 CCTTACACAGAAATAACTTTCCA No data
Right 980294138 4:130888446-130888468 GACAAAAATGTTTTAATCTCAGG No data
980294135_980294138 18 Left 980294135 4:130888405-130888427 CCAGGACACTTGTCCTTACACAG No data
Right 980294138 4:130888446-130888468 GACAAAAATGTTTTAATCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980294138 Original CRISPR GACAAAAATGTTTTAATCTC AGG Intergenic
No off target data available for this crispr