ID: 980296124

View in Genome Browser
Species Human (GRCh38)
Location 4:130920160-130920182
Sequence CTGTTGTTTTGAAGTAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980296124_980296129 29 Left 980296124 4:130920160-130920182 CCATTTTTACTTCAAAACAACAG No data
Right 980296129 4:130920212-130920234 ATTTTTCACTTCTAAGCCCATGG No data
980296124_980296128 -6 Left 980296124 4:130920160-130920182 CCATTTTTACTTCAAAACAACAG No data
Right 980296128 4:130920177-130920199 CAACAGAGATGGTAAAATTGGGG No data
980296124_980296126 -8 Left 980296124 4:130920160-130920182 CCATTTTTACTTCAAAACAACAG No data
Right 980296126 4:130920175-130920197 AACAACAGAGATGGTAAAATTGG No data
980296124_980296127 -7 Left 980296124 4:130920160-130920182 CCATTTTTACTTCAAAACAACAG No data
Right 980296127 4:130920176-130920198 ACAACAGAGATGGTAAAATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980296124 Original CRISPR CTGTTGTTTTGAAGTAAAAA TGG (reversed) Intergenic
No off target data available for this crispr