ID: 980302763

View in Genome Browser
Species Human (GRCh38)
Location 4:131015006-131015028
Sequence AAAAGGTAAGCCCAAAGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980302763_980302774 25 Left 980302763 4:131015006-131015028 CCCAGTCTTTGGGCTTACCTTTT No data
Right 980302774 4:131015054-131015076 GCAAATGGTGGAGGGTGTCTAGG No data
980302763_980302772 16 Left 980302763 4:131015006-131015028 CCCAGTCTTTGGGCTTACCTTTT No data
Right 980302772 4:131015045-131015067 TCAAAATATGCAAATGGTGGAGG No data
980302763_980302770 10 Left 980302763 4:131015006-131015028 CCCAGTCTTTGGGCTTACCTTTT No data
Right 980302770 4:131015039-131015061 GGCTCGTCAAAATATGCAAATGG No data
980302763_980302773 17 Left 980302763 4:131015006-131015028 CCCAGTCTTTGGGCTTACCTTTT No data
Right 980302773 4:131015046-131015068 CAAAATATGCAAATGGTGGAGGG No data
980302763_980302771 13 Left 980302763 4:131015006-131015028 CCCAGTCTTTGGGCTTACCTTTT No data
Right 980302771 4:131015042-131015064 TCGTCAAAATATGCAAATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980302763 Original CRISPR AAAAGGTAAGCCCAAAGACT GGG (reversed) Intergenic
No off target data available for this crispr