ID: 980302764

View in Genome Browser
Species Human (GRCh38)
Location 4:131015007-131015029
Sequence GAAAAGGTAAGCCCAAAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980302764_980302771 12 Left 980302764 4:131015007-131015029 CCAGTCTTTGGGCTTACCTTTTC No data
Right 980302771 4:131015042-131015064 TCGTCAAAATATGCAAATGGTGG No data
980302764_980302770 9 Left 980302764 4:131015007-131015029 CCAGTCTTTGGGCTTACCTTTTC No data
Right 980302770 4:131015039-131015061 GGCTCGTCAAAATATGCAAATGG No data
980302764_980302773 16 Left 980302764 4:131015007-131015029 CCAGTCTTTGGGCTTACCTTTTC No data
Right 980302773 4:131015046-131015068 CAAAATATGCAAATGGTGGAGGG No data
980302764_980302774 24 Left 980302764 4:131015007-131015029 CCAGTCTTTGGGCTTACCTTTTC No data
Right 980302774 4:131015054-131015076 GCAAATGGTGGAGGGTGTCTAGG No data
980302764_980302772 15 Left 980302764 4:131015007-131015029 CCAGTCTTTGGGCTTACCTTTTC No data
Right 980302772 4:131015045-131015067 TCAAAATATGCAAATGGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980302764 Original CRISPR GAAAAGGTAAGCCCAAAGAC TGG (reversed) Intergenic
No off target data available for this crispr