ID: 980302767

View in Genome Browser
Species Human (GRCh38)
Location 4:131015023-131015045
Sequence ACGAGCCAGCCAGGAGGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980302767_980302773 0 Left 980302767 4:131015023-131015045 CCTTTTCCTCCTGGCTGGCTCGT No data
Right 980302773 4:131015046-131015068 CAAAATATGCAAATGGTGGAGGG No data
980302767_980302770 -7 Left 980302767 4:131015023-131015045 CCTTTTCCTCCTGGCTGGCTCGT No data
Right 980302770 4:131015039-131015061 GGCTCGTCAAAATATGCAAATGG No data
980302767_980302774 8 Left 980302767 4:131015023-131015045 CCTTTTCCTCCTGGCTGGCTCGT No data
Right 980302774 4:131015054-131015076 GCAAATGGTGGAGGGTGTCTAGG No data
980302767_980302771 -4 Left 980302767 4:131015023-131015045 CCTTTTCCTCCTGGCTGGCTCGT No data
Right 980302771 4:131015042-131015064 TCGTCAAAATATGCAAATGGTGG No data
980302767_980302772 -1 Left 980302767 4:131015023-131015045 CCTTTTCCTCCTGGCTGGCTCGT No data
Right 980302772 4:131015045-131015067 TCAAAATATGCAAATGGTGGAGG No data
980302767_980302775 15 Left 980302767 4:131015023-131015045 CCTTTTCCTCCTGGCTGGCTCGT No data
Right 980302775 4:131015061-131015083 GTGGAGGGTGTCTAGGTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980302767 Original CRISPR ACGAGCCAGCCAGGAGGAAA AGG (reversed) Intergenic
No off target data available for this crispr