ID: 980302768

View in Genome Browser
Species Human (GRCh38)
Location 4:131015029-131015051
Sequence ATTTTGACGAGCCAGCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980302768_980302776 29 Left 980302768 4:131015029-131015051 CCTCCTGGCTGGCTCGTCAAAAT No data
Right 980302776 4:131015081-131015103 TGGCATCTTGAACAAAGAATCGG 0: 88
1: 211
2: 280
3: 306
4: 890
980302768_980302772 -7 Left 980302768 4:131015029-131015051 CCTCCTGGCTGGCTCGTCAAAAT No data
Right 980302772 4:131015045-131015067 TCAAAATATGCAAATGGTGGAGG No data
980302768_980302775 9 Left 980302768 4:131015029-131015051 CCTCCTGGCTGGCTCGTCAAAAT No data
Right 980302775 4:131015061-131015083 GTGGAGGGTGTCTAGGTTCTTGG No data
980302768_980302773 -6 Left 980302768 4:131015029-131015051 CCTCCTGGCTGGCTCGTCAAAAT No data
Right 980302773 4:131015046-131015068 CAAAATATGCAAATGGTGGAGGG No data
980302768_980302771 -10 Left 980302768 4:131015029-131015051 CCTCCTGGCTGGCTCGTCAAAAT No data
Right 980302771 4:131015042-131015064 TCGTCAAAATATGCAAATGGTGG No data
980302768_980302774 2 Left 980302768 4:131015029-131015051 CCTCCTGGCTGGCTCGTCAAAAT No data
Right 980302774 4:131015054-131015076 GCAAATGGTGGAGGGTGTCTAGG No data
980302768_980302777 30 Left 980302768 4:131015029-131015051 CCTCCTGGCTGGCTCGTCAAAAT No data
Right 980302777 4:131015082-131015104 GGCATCTTGAACAAAGAATCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980302768 Original CRISPR ATTTTGACGAGCCAGCCAGG AGG (reversed) Intergenic
No off target data available for this crispr