ID: 980302770

View in Genome Browser
Species Human (GRCh38)
Location 4:131015039-131015061
Sequence GGCTCGTCAAAATATGCAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980302763_980302770 10 Left 980302763 4:131015006-131015028 CCCAGTCTTTGGGCTTACCTTTT No data
Right 980302770 4:131015039-131015061 GGCTCGTCAAAATATGCAAATGG No data
980302767_980302770 -7 Left 980302767 4:131015023-131015045 CCTTTTCCTCCTGGCTGGCTCGT No data
Right 980302770 4:131015039-131015061 GGCTCGTCAAAATATGCAAATGG No data
980302764_980302770 9 Left 980302764 4:131015007-131015029 CCAGTCTTTGGGCTTACCTTTTC No data
Right 980302770 4:131015039-131015061 GGCTCGTCAAAATATGCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980302770 Original CRISPR GGCTCGTCAAAATATGCAAA TGG Intergenic
No off target data available for this crispr