ID: 980302771

View in Genome Browser
Species Human (GRCh38)
Location 4:131015042-131015064
Sequence TCGTCAAAATATGCAAATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980302767_980302771 -4 Left 980302767 4:131015023-131015045 CCTTTTCCTCCTGGCTGGCTCGT No data
Right 980302771 4:131015042-131015064 TCGTCAAAATATGCAAATGGTGG No data
980302768_980302771 -10 Left 980302768 4:131015029-131015051 CCTCCTGGCTGGCTCGTCAAAAT No data
Right 980302771 4:131015042-131015064 TCGTCAAAATATGCAAATGGTGG No data
980302764_980302771 12 Left 980302764 4:131015007-131015029 CCAGTCTTTGGGCTTACCTTTTC No data
Right 980302771 4:131015042-131015064 TCGTCAAAATATGCAAATGGTGG No data
980302763_980302771 13 Left 980302763 4:131015006-131015028 CCCAGTCTTTGGGCTTACCTTTT No data
Right 980302771 4:131015042-131015064 TCGTCAAAATATGCAAATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980302771 Original CRISPR TCGTCAAAATATGCAAATGG TGG Intergenic
No off target data available for this crispr