ID: 980302773

View in Genome Browser
Species Human (GRCh38)
Location 4:131015046-131015068
Sequence CAAAATATGCAAATGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980302763_980302773 17 Left 980302763 4:131015006-131015028 CCCAGTCTTTGGGCTTACCTTTT No data
Right 980302773 4:131015046-131015068 CAAAATATGCAAATGGTGGAGGG No data
980302768_980302773 -6 Left 980302768 4:131015029-131015051 CCTCCTGGCTGGCTCGTCAAAAT No data
Right 980302773 4:131015046-131015068 CAAAATATGCAAATGGTGGAGGG No data
980302769_980302773 -9 Left 980302769 4:131015032-131015054 CCTGGCTGGCTCGTCAAAATATG No data
Right 980302773 4:131015046-131015068 CAAAATATGCAAATGGTGGAGGG No data
980302764_980302773 16 Left 980302764 4:131015007-131015029 CCAGTCTTTGGGCTTACCTTTTC No data
Right 980302773 4:131015046-131015068 CAAAATATGCAAATGGTGGAGGG No data
980302767_980302773 0 Left 980302767 4:131015023-131015045 CCTTTTCCTCCTGGCTGGCTCGT No data
Right 980302773 4:131015046-131015068 CAAAATATGCAAATGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980302773 Original CRISPR CAAAATATGCAAATGGTGGA GGG Intergenic
No off target data available for this crispr