ID: 980302775

View in Genome Browser
Species Human (GRCh38)
Location 4:131015061-131015083
Sequence GTGGAGGGTGTCTAGGTTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980302768_980302775 9 Left 980302768 4:131015029-131015051 CCTCCTGGCTGGCTCGTCAAAAT No data
Right 980302775 4:131015061-131015083 GTGGAGGGTGTCTAGGTTCTTGG No data
980302769_980302775 6 Left 980302769 4:131015032-131015054 CCTGGCTGGCTCGTCAAAATATG No data
Right 980302775 4:131015061-131015083 GTGGAGGGTGTCTAGGTTCTTGG No data
980302767_980302775 15 Left 980302767 4:131015023-131015045 CCTTTTCCTCCTGGCTGGCTCGT No data
Right 980302775 4:131015061-131015083 GTGGAGGGTGTCTAGGTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980302775 Original CRISPR GTGGAGGGTGTCTAGGTTCT TGG Intergenic
No off target data available for this crispr