ID: 980302776

View in Genome Browser
Species Human (GRCh38)
Location 4:131015081-131015103
Sequence TGGCATCTTGAACAAAGAAT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1775
Summary {0: 88, 1: 211, 2: 280, 3: 306, 4: 890}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980302768_980302776 29 Left 980302768 4:131015029-131015051 CCTCCTGGCTGGCTCGTCAAAAT No data
Right 980302776 4:131015081-131015103 TGGCATCTTGAACAAAGAATCGG 0: 88
1: 211
2: 280
3: 306
4: 890
980302769_980302776 26 Left 980302769 4:131015032-131015054 CCTGGCTGGCTCGTCAAAATATG No data
Right 980302776 4:131015081-131015103 TGGCATCTTGAACAAAGAATCGG 0: 88
1: 211
2: 280
3: 306
4: 890

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980302776 Original CRISPR TGGCATCTTGAACAAAGAAT CGG Intergenic
900016528 1:154364-154386 GGGCACCTTGAAAAAAGAACAGG + Intergenic
900046788 1:512956-512978 GGGCACCTTGAAAAAAGAACAGG + Intergenic
900068993 1:754674-754696 GGGCACCTTGAAAAAAGAACAGG + Intergenic
900468722 1:2839896-2839918 TGGCTTTTTGCACAAAGAGTTGG + Intergenic
900653231 1:3741634-3741656 TGGCCTTTTGAACAAAGAATTGG - Intergenic
900936175 1:5767552-5767574 GGGCATCTTGAAAAAAGAACAGG - Intergenic
900982498 1:6054280-6054302 TGGCATCTTGAACAAAGAATTGG + Intronic
902032803 1:13435056-13435078 TGGTGTTTTGAACAAAGAATTGG - Intergenic
902524367 1:17045986-17046008 TAGCATGTTGAACAAAAAATTGG - Intronic
903087134 1:20871779-20871801 TGTCATCTTGAAAAAGCAATTGG + Intronic
903101026 1:21029729-21029751 TGCCATCTTGAGAAAAGAAATGG + Intronic
903862895 1:26375682-26375704 TGGCATCTTGAACAAAGAATTGG + Intergenic
903979962 1:27178672-27178694 TGGCATCTTGAACAAAGAATTGG - Intergenic
903981218 1:27189701-27189723 TGGCGTCTTGAACAAAGAATTGG - Intergenic
904377640 1:30091794-30091816 GGGCATCTTGAAGAATGAATAGG + Intergenic
904734333 1:32619116-32619138 TGGCGTTTTGAACAAATAATTGG - Intronic
904981078 1:34502313-34502335 TGGCACCTTGAATAAAGATATGG + Intergenic
905078893 1:35299298-35299320 TGGCGTCTTGAACAAAGAATTGG + Intronic
905187436 1:36206767-36206789 TGGCGTCTTGAACAAAGAATTGG - Intergenic
905216472 1:36411821-36411843 TGGCATTTTGAACAAAGAATTGG + Intergenic
906588800 1:47004296-47004318 TGGTGTCTTGAACAAAGAATTGG - Intergenic
906729178 1:48066581-48066603 TGGCATCTTGAGGAAAGAGAAGG - Intergenic
906737291 1:48142626-48142648 TGACTTATTGAACAAGGAATTGG - Intergenic
907183294 1:52589586-52589608 TGGTGTCTTGAACAAAGAATTGG - Intergenic
907213264 1:52841224-52841246 TGGTGTCTTGAACAAAGAATTGG - Intergenic
907251633 1:53143360-53143382 TGTCATCTTTAAAAAATAATAGG - Intergenic
907378411 1:54064292-54064314 TGGCGTTTTGAACAAAGAATTGG + Intronic
907506768 1:54924754-54924776 GGGCACCTTGAAAAAAGAACAGG - Intergenic
907510645 1:54955865-54955887 TGGCATCTTGAACAAAGAATTGG - Intergenic
907511416 1:54963871-54963893 TGGCATCTTGAACAAAGAATTGG - Intergenic
907622592 1:55996506-55996528 GGGCACCTTGAATAAAGAACAGG - Intergenic
907957264 1:59241701-59241723 TGGAGTCTTGAACAAGGAGTGGG + Intergenic
908019693 1:59887025-59887047 GGGCACCTTGAAAAAAGAACAGG + Intergenic
908045327 1:60162227-60162249 GGGCACCTTGAAAAAAGAACAGG - Intergenic
908093043 1:60706821-60706843 TGGGGTCTTGAACAAAGTAGTGG - Intergenic
908115968 1:60940613-60940635 TGGCATCTTGAACAAAGAACTGG + Intronic
908542903 1:65138362-65138384 TGGCATCTTGAACAAAGAATTGG + Intergenic
909013943 1:70363577-70363599 TGGCATCTTGAACAAAGAATTGG - Intronic
909136311 1:71804805-71804827 GGGCACCTTGAAAAAAGAACAGG + Intronic
909254878 1:73407659-73407681 GGGCACCTTGAAAAAAGAACAGG + Intergenic
909315654 1:74214627-74214649 TGGCATTTTGAACAAAGAACTGG - Intronic
909464766 1:75960973-75960995 GGGCACCTTGAAAAAAGAACAGG + Intergenic
909577227 1:77188118-77188140 GGGCATCTTGAAAAAAGAACAGG + Intronic
909706815 1:78595115-78595137 TGGCATTTTAAATAAAGAATTGG - Intergenic
909741874 1:79039010-79039032 TGGCGTTTTGAACAAAGAATTGG + Intergenic
909749225 1:79138056-79138078 GGGCACCTTGAAAAAAGAACAGG + Intergenic
909812930 1:79953903-79953925 GGGCACCTTGAAAAAAGAACAGG - Intergenic
909824864 1:80115362-80115384 TGGCATCTTGAACAAAGAATTGG + Intergenic
909825449 1:80120869-80120891 TGGTGTCTTCAACAAATAATTGG + Intergenic
909899470 1:81114414-81114436 TGGCGGCTTGAACAAAGAATTGG + Intergenic
910587145 1:88892427-88892449 TGGCGTTTTGAACAAAGAACTGG + Intergenic
910605559 1:89080016-89080038 GGGCACCTTGAAAAAAGAACAGG + Intergenic
910614258 1:89179825-89179847 TGGTATCTTGAACAAAGGATTGG - Intergenic
910734935 1:90443239-90443261 TGGTGTTTTGAACAAATAATTGG + Intergenic
910809802 1:91224560-91224582 TGGTGTCTTGAACAAAGAATTGG - Intergenic
911083090 1:93952395-93952417 GGGCACCTTGAAAAAAGAACAGG - Intergenic
911734718 1:101324492-101324514 TGGCATTTTGAACAAAGAATTGG - Intergenic
911896130 1:103437100-103437122 GGGCACCTTGAAAAAAGAACAGG - Intergenic
911940833 1:104045237-104045259 GGGCACCTTGAAAAAAGAACAGG - Intergenic
912027651 1:105198836-105198858 TGGCATCTTGAACAAAGAATTGG - Intergenic
912097305 1:106161325-106161347 AGGCACCTTGAAAAAAGAACAGG + Intergenic
912166493 1:107047718-107047740 CAGCATCTTGAACAAAGAATGGG + Intergenic
912303417 1:108540302-108540324 GGGCACCTTGAAAAAAGAACAGG + Intergenic
912434378 1:109649804-109649826 TCGCATTTTGAACAAAGAACTGG - Intergenic
912689485 1:111793778-111793800 TGGAATTTTGAAGAAAGAAAGGG + Intronic
912807125 1:112765997-112766019 GGGCACCTTGAAAAAAGAACAGG + Intergenic
912882401 1:113429309-113429331 TGGCATTTTGAACAAAGAATTGG + Intronic
913024551 1:114824074-114824096 GGGCACCTTGAAAAAAGAACAGG + Intergenic
913995466 1:143648914-143648936 TGGTGTCTCAAACAAAGAATTGG - Intergenic
914360809 1:146934291-146934313 TGGTGTCTTTAACAAAGAATTGG + Intergenic
914491773 1:148156347-148156369 TGGTGTCTTTAACAAAGAATTGG - Intergenic
914528012 1:148489841-148489863 TGACAACTTGAAATAAGAATGGG + Intergenic
914929985 1:151922428-151922450 TGGTGTCCTGAACAAAGAAGTGG - Intergenic
914956350 1:152166179-152166201 TGTCATCTTGAACAAAGAATTGG + Intergenic
915055407 1:153124165-153124187 GGGCACCTTGAAAAAAGAACAGG - Intergenic
915208036 1:154285681-154285703 TGGCGTCTTGAAAGAAGAATTGG + Intergenic
915364530 1:155307222-155307244 TGGCATCTTGAACAAAGAATTGG - Intergenic
915448363 1:155987940-155987962 GGGCACCTTGAAAAAAGAACAGG + Intronic
915676501 1:157537094-157537116 GGGCACCTTGAAAAAAGAACAGG + Intronic
915744885 1:158148264-158148286 TGGCGTTTTCAACAAAGGATTGG - Intergenic
915749451 1:158192591-158192613 GGGCACCCTGAAAAAAGAATAGG + Intergenic
915862860 1:159465687-159465709 TGGTGTTTTGAACAAAGAGTTGG - Intergenic
915886195 1:159723586-159723608 GGGCATCTTGAAAAAAGAACAGG - Intergenic
916625742 1:166553281-166553303 TGGGGTTTTGAACAAAGAATTGG - Intergenic
916626256 1:166558423-166558445 TGGCATTTTGGACAAAGAATGGG - Intergenic
916626953 1:166568214-166568236 GGGCACCTTGAAAAAAGAATAGG - Intergenic
916639994 1:166717510-166717532 TGGCATCTTGAACAAAGAATTGG - Intergenic
916917975 1:169430646-169430668 TGGTATTTTGAACAAAGAATTGG + Intronic
917164661 1:172098434-172098456 GGGCACCTTGAAAAAAGAACAGG - Intronic
917351062 1:174078145-174078167 TGGTGTTTTGAACAAAGAATTGG - Intergenic
917821195 1:178765926-178765948 GGGCACCTTGAAAAAAGAACAGG - Intronic
917831784 1:178897665-178897687 TAGCATCTTGGACAAAATATTGG + Exonic
917924156 1:179774946-179774968 TGACGTTTTGAACAAAGAATTGG + Intronic
918281569 1:183011112-183011134 GGGCACCTTGAAAAAAGAACAGG - Intergenic
918331306 1:183463602-183463624 TGTCCTCTTGGACAAAGAAATGG + Intergenic
918345999 1:183607885-183607907 TGGTCTCTTGAGCAAAGACTAGG + Intergenic
918395043 1:184105201-184105223 TACCATCTTGAACACAGGATTGG - Intergenic
918629862 1:186703638-186703660 TGGCATCTTGAACAAAGAATTGG - Intergenic
918744407 1:188182022-188182044 GGGCACCTTGAAAAAAGAAAAGG + Intergenic
919069828 1:192739902-192739924 TGGCGTTTTGAACAAAAAATTGG - Intergenic
919190028 1:194204219-194204241 GGGCACCTTGAAAAAAGAACAGG - Intergenic
919192690 1:194244317-194244339 TGTCTTCTTGAAACAAGAATTGG - Intergenic
919296147 1:195702898-195702920 GGGCACCTTGAAAAAAGAACAGG - Intergenic
919318594 1:196004983-196005005 GGGCACCTTGAAAAAAGAACAGG - Intergenic
919621122 1:199865673-199865695 TGGCGTTTTGAACAAAGAATTGG + Intergenic
920062185 1:203234870-203234892 GGGCACCTTGAAAAAAGAACAGG + Intronic
920213720 1:204347404-204347426 GGGCACCTTGAAAAAAGAACAGG - Intronic
920684523 1:208099238-208099260 TGATGTCTTGAACAAAGAATTGG + Intronic
920768307 1:208854724-208854746 TGGCATCTTGAACAAAGAATTGG - Intergenic
920899211 1:210089766-210089788 TGGTGTTTTGAACAAAGAATTGG + Intronic
920950583 1:210568480-210568502 TGGCATTTTGAACAAAGAATTGG + Intronic
921169458 1:212533579-212533601 TGGCATTTTGAACAAAGAATTGG - Intergenic
921410105 1:214826624-214826646 TGGCGTTTTGAACAAAGAATTGG + Intergenic
921982783 1:221276219-221276241 TGGTGTTTTGAACAAAGAGTTGG - Intergenic
921985821 1:221310665-221310687 TTACATCTTGAAGAAAGAAAAGG + Intergenic
922104351 1:222500067-222500089 GGGCACCTTGAAAAAAGAACAGG + Intergenic
922167591 1:223128901-223128923 TGGCGTTTTGAACAAAGAATTGG - Intronic
922264671 1:223972588-223972610 GGGCACCTTGAAAAAAGAACAGG + Intergenic
922361101 1:224822160-224822182 GGGCACCTTGAAAAAAGAACAGG - Intergenic
922371874 1:224919485-224919507 TGGCATTTCGAACAAAGAATTGG + Intronic
922505777 1:226124675-226124697 TGGCATCTTGAACAAAGAATTGG - Intergenic
922968929 1:229717688-229717710 TGGCGTTTTGAACAAAGAATTGG + Intergenic
923170999 1:231417182-231417204 TGGCTTTTAGAGCAAAGAATAGG - Intronic
923172751 1:231431991-231432013 TGGTGTTTTGAACAAAGAATTGG + Intergenic
923419628 1:233799560-233799582 GGGCACCTTGAAAAAAGAACAGG - Intergenic
923633269 1:235669835-235669857 TGGTGTTTTGAACAAAGAATTGG - Intronic
923943947 1:238861651-238861673 TGTCATCTTGAACAAAGAATTGG + Intergenic
924127526 1:240870677-240870699 TAGCATCTTCAACAAATAAGAGG + Intronic
924251067 1:242133487-242133509 TGGTGTTTTGAACAAAGAATTGG - Intronic
924295734 1:242585573-242585595 TGGCATACTGAACAAAGAATTGG - Intergenic
924346528 1:243077585-243077607 GGGCACCTTGAAAAAAGAACAGG + Intergenic
924358916 1:243215263-243215285 GGGCACCTTGAAAAAAGAACAGG + Intronic
924371335 1:243353579-243353601 TGGCAGCTTGAGCAAAGGAATGG + Intronic
924490057 1:244527468-244527490 GGGCACCTTGAAAAAAGAACAGG - Intronic
924547671 1:245045348-245045370 TGGCATTTTGAACAAAGAATTGG + Intronic
924789204 1:247228506-247228528 TGGCATTTTGAACAAAGAATTGG - Intergenic
924869584 1:248026937-248026959 GGGCACCTTGAAAAAAGAACAGG + Intronic
924928752 1:248708768-248708790 TGGCGTTTTGAACAAAGAATTGG + Intergenic
1062932442 10:1362373-1362395 TGGCGCCTTGAGCAAAGAACTGG - Intronic
1063080273 10:2761219-2761241 TGGCATTTTGAACAAATAATTGG - Intergenic
1063112825 10:3051782-3051804 TGGCACCTTGAACAAAGAATTGG + Intergenic
1063322607 10:5065500-5065522 TGGCTTCTTGAACAAAGAATTGG + Intronic
1063496817 10:6517055-6517077 TGACATCTAGAAGACAGAATAGG + Intronic
1063689990 10:8277885-8277907 TGGCATTTTAAAAAAAAAATAGG - Intergenic
1064152657 10:12877688-12877710 CGGCATCTCTAACAAAGAATTGG - Intergenic
1064237316 10:13587851-13587873 TGGCGTTTTGAACAAAGAATTGG - Intronic
1064278958 10:13933482-13933504 TGGCATCTTGAACAAACAATGGG - Intronic
1064352019 10:14585239-14585261 TGGCATTTTGAACAAAGAATTGG - Intronic
1064377801 10:14812741-14812763 TGGCGTTTTGAACAAAGAATTGG - Intergenic
1064408381 10:15084445-15084467 TGGCATTTTGAACAAAAAATTGG + Intronic
1064426509 10:15234380-15234402 TGGCGTTTTGAACAAAGAATTGG + Intronic
1064745721 10:18476291-18476313 TGGCGTCTTCAACAAAGAATTGG + Intronic
1065053348 10:21818008-21818030 GGGCACCTTGAAAAAAGAACAGG + Intronic
1065153561 10:22847214-22847236 CGGCGTCTTGATCAAAGATTTGG + Intergenic
1065428511 10:25630487-25630509 TGGCGTCTTGAACAAAGAATTGG - Intergenic
1065432463 10:25673587-25673609 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1065512520 10:26493211-26493233 GGGCACCTTGAAAAAAGAACAGG - Intronic
1065701430 10:28429657-28429679 TGGCATTTTGAACAAACAATTGG + Intergenic
1065756833 10:28938362-28938384 TGGCATTTTGAACAAAGAATTGG - Intergenic
1065781614 10:29174235-29174257 TGGCATTTTGAACAAAGAATTGG + Intergenic
1065850235 10:29781682-29781704 TGGCGTCTTAAACAAAGAATTGG + Intergenic
1066202260 10:33153086-33153108 TGCCATTTTGAACACAGAGTTGG + Intergenic
1066270268 10:33815735-33815757 TAGCATTTTGAACAAAGAATTGG + Intergenic
1066626612 10:37413318-37413340 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1066672111 10:37851465-37851487 TGGCATCTTCATCAAAGAACAGG - Intronic
1066698521 10:38100640-38100662 GGGCACCTTGAAAAAAGAACAGG - Intronic
1066729819 10:38427261-38427283 GGGCACCTTGAATAAAGAACAGG - Intergenic
1067246330 10:44549599-44549621 TGGCGTTTTGAACAAAGAATTGG - Intergenic
1067303093 10:45032314-45032336 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1067348000 10:45451766-45451788 CCGCATTTTGAACAAAAAATTGG + Intergenic
1067403585 10:46000045-46000067 GGGCACCTTGAAAAAAGAACAGG - Intronic
1067825970 10:49573063-49573085 TGGTGTTTTGAACAAAGAATTGG + Intergenic
1067920021 10:50445736-50445758 GGGCACCTTGAAAAAAGAACAGG + Intronic
1067995515 10:51268620-51268642 GGGCACCTTGAAAAAAGAACAGG - Intronic
1068014743 10:51501720-51501742 TGCCCTCTTGAATAAAGAAAGGG - Intronic
1068026293 10:51649607-51649629 TGGTGTTTTGAACAAAGAATTGG + Intronic
1068515584 10:58021765-58021787 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1068662625 10:59638041-59638063 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1069045228 10:63736442-63736464 TGGCAGCTTGAACAGATAAATGG - Intergenic
1069214201 10:65798986-65799008 TGGCGTCTTGAACAAAGAATTGG + Intergenic
1069288087 10:66741996-66742018 GGGCACCTTGAAAAAAGAACAGG + Intronic
1069737677 10:70668079-70668101 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1070314863 10:75300308-75300330 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1070381178 10:75881852-75881874 TGGAAGTTTGGACAAAGAATTGG - Intronic
1071011671 10:80947619-80947641 TGGCATCTTGAACAAAGAATTGG + Intergenic
1071049592 10:81430210-81430232 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1071183877 10:83018758-83018780 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1071300803 10:84254498-84254520 TGGTGTCCCGAACAAAGAATTGG + Intronic
1071380621 10:85055856-85055878 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1071589044 10:86854253-86854275 GGGCACCTTGAAAAAAGAACAGG - Intronic
1071697306 10:87890065-87890087 TGGCTTGTTGAAGAGAGAATGGG + Intronic
1071761181 10:88609129-88609151 TGGCATTTTGAACAAAGAATTGG - Intergenic
1071870130 10:89784998-89785020 TGGCATATCAAACAAAGAATTGG + Intergenic
1072036651 10:91569032-91569054 TGGTGTTTTGAACAAAGAATTGG + Intergenic
1072213547 10:93268856-93268878 TGGTGTCTTGAACAAAGAATTGG + Intergenic
1072473196 10:95733324-95733346 GGGCACCTTGAAAAAAGAACAGG - Intronic
1072498286 10:95985635-95985657 GGGCACCTTGAAAAAAGAACAGG + Intronic
1072523192 10:96248014-96248036 TGGCCTTTTGAACACAGAATTGG - Intronic
1072823599 10:98583417-98583439 TGGCATTTTGAACAAAGAATTGG - Intronic
1072883966 10:99257231-99257253 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1072921164 10:99578485-99578507 TGGGGTCTTGAACAAAGAATTGG - Intergenic
1073669242 10:105568998-105569020 TGGTGTTTTGAACAAAGAATTGG - Intergenic
1073678541 10:105677525-105677547 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1073822047 10:107275098-107275120 TGGCATTTTGAACAAAGAATTGG + Intergenic
1073994541 10:109300673-109300695 TGGCATTTTGAACAAAAAATTGG + Intergenic
1074271325 10:111956796-111956818 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1074343014 10:112652905-112652927 TGGCATCTTGAACAAAGAATTGG + Intronic
1074438633 10:113455678-113455700 TGTTGTTTTGAACAAAGAATTGG + Intergenic
1074464648 10:113670675-113670697 TGGTGTTTTGAACAAAGAATTGG - Intergenic
1074688881 10:115985535-115985557 TGACGTCTTGAACAAAGAATTGG + Intergenic
1074695809 10:116049578-116049600 CGGCACTTTGAACAAAGAATTGG - Intergenic
1074983867 10:118640720-118640742 TGGCACCTTGAAAAAAGAACAGG - Intergenic
1075190107 10:120299486-120299508 TGGCATCTTGAACAAAGAATTGG - Intergenic
1075506188 10:123024616-123024638 TGGCATTTTGAACAAAGAGTTGG + Intronic
1075603091 10:123785185-123785207 TGGCATCTTCAATAAAGAATTGG - Intronic
1075889039 10:125929687-125929709 TGGCATCTTGAACAGAGAATTGG + Intronic
1075914579 10:126156605-126156627 TGGTGTTTTGAACAAAGAATTGG - Intronic
1075997558 10:126890981-126891003 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1076181564 10:128413037-128413059 TGGCGTTTTGAATAAAGAATTGG - Intergenic
1076652860 10:132001991-132002013 TGGTGTTTTGAACAAAGAATTGG - Intergenic
1076653786 10:132007860-132007882 TGGTGTCTTGAACAAAGAATTGG - Intergenic
1076654576 10:132015165-132015187 CGGTGTCTGGAACAAAGAATTGG - Intergenic
1076908314 10:133374077-133374099 TGACGTCTTGAACAAAGAACTGG + Intergenic
1076973118 11:149433-149455 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1077005409 11:353063-353085 TGGTTTCTTGAACAAAGAACTGG - Intergenic
1077262980 11:1632867-1632889 TGGCTTCTCAAACAAAGAATTGG + Intergenic
1077827264 11:5824741-5824763 TGGCGTCTTGAACAAAGAATTGG - Intronic
1078314847 11:10285794-10285816 TGGTGTTTTGAAGAAAGAATTGG - Intronic
1078387890 11:10909031-10909053 TGGCATTTTGAACAAAGAATCGG - Intergenic
1078499641 11:11858197-11858219 TGGCGTTTTGAACAAAGAATTGG - Intronic
1078777472 11:14407076-14407098 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1078804086 11:14679436-14679458 TGGTGTCTTGAACAAAGAATTGG - Intronic
1078839339 11:15063654-15063676 GGGCACCTTGAAAAAAGAACAGG - Intronic
1078840084 11:15070172-15070194 GGGCACCTTGAAAAAAGAACAGG - Intronic
1078943628 11:16037752-16037774 TGGCAGTTTAAATAAAGAATGGG - Intronic
1079742131 11:24076052-24076074 TGGCGTTTTGAGCAAAGATTTGG + Intergenic
1079829556 11:25245411-25245433 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1079988106 11:27219153-27219175 TGGCATCTTGGACAAAGAATTGG - Intergenic
1080203619 11:29704711-29704733 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1081009964 11:37798472-37798494 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1081179930 11:39972586-39972608 TGGCATTTTGGACAAAGAATTGG + Intergenic
1081461283 11:43274919-43274941 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1081526566 11:43931797-43931819 TGCCATCTTGAATAAAGTAGGGG + Intronic
1081531380 11:43962038-43962060 GGGCATCTTGAACAAAGAATGGG - Intergenic
1082198323 11:49330621-49330643 TGCCATATTGAAGAAATAATTGG + Intergenic
1082295614 11:50438436-50438458 GGGCATCATGAAAAAAGAACAGG + Intergenic
1082296566 11:50447272-50447294 GGGCACCTTGAAAAAAGAAAAGG + Intergenic
1082299440 11:50488544-50488566 GGGCACCTTGAAAAAAGAAGAGG - Intergenic
1082778024 11:57262975-57262997 TGGCATTTTGAACAAAGAATTGG - Intergenic
1082778574 11:57268174-57268196 TGGTGTTTTGAACAAAGAATTGG - Intergenic
1082919160 11:58473593-58473615 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1082936404 11:58661314-58661336 TGGTGTTTTGAACAAAGAATTGG + Intronic
1082960771 11:58916743-58916765 TGGCATTTTAAAGAAAGAATTGG + Intronic
1083092720 11:60217884-60217906 GGGCACCTTGAAAAAAGAACAGG + Intronic
1083376821 11:62230265-62230287 TGGCATCTTGAATGAAGAATTGG - Intergenic
1083459595 11:62802001-62802023 TGGCGTCTTCAACGAAGAACTGG + Exonic
1083520995 11:63312849-63312871 GGGCACCTTGAAAAAAGAACAGG - Intronic
1084098051 11:66925545-66925567 GGGCACCTTGAAAAAAGAACAGG - Intronic
1084198514 11:67540388-67540410 TGGTGTTTTGAACCAAGAATTGG - Intergenic
1084735373 11:71102134-71102156 TGGCAACTTGAACAAAATTTAGG - Intronic
1084789479 11:71464251-71464273 TGACATTTTGAACAAAGAATGGG + Intronic
1084874181 11:72118470-72118492 TGGTGTCCTGAACAAAGAACTGG + Intronic
1085240289 11:75047594-75047616 TGGCATCTTGAACAAAGAACTGG - Intergenic
1085333812 11:75674454-75674476 TGGCATTTTGAAGAAGGAATTGG - Intergenic
1085357249 11:75849831-75849853 AGGTGTTTTGAACAAAGAATTGG + Intronic
1085479671 11:76810749-76810771 TGGCATCTTGAACAGAGAATTGG + Intergenic
1085480602 11:76819879-76819901 TGGCGTCTTGAACAAAGAATTGG + Intergenic
1085581707 11:77656814-77656836 TGGCGCTTTGAACAAAGAATTGG - Intergenic
1086069349 11:82782586-82782608 TGGCATTTTGAACAAAGAATTGG - Intergenic
1086572492 11:88301535-88301557 TGGCTTCTTGAACAAAGAATTGG - Intronic
1086657482 11:89377489-89377511 TGCCATATTGAAGAAATAATTGG - Intronic
1086929549 11:92677760-92677782 TGGTGTTTTGAACAAATAATTGG + Intronic
1087050789 11:93884417-93884439 TGGTTTCTTGAACAAAGAATTGG + Intergenic
1087123681 11:94600964-94600986 GGGCACCTTGAAAAAAGAACAGG - Intronic
1087129668 11:94657485-94657507 TGGCGCCTCAAACAAAGAATTGG - Intergenic
1087219188 11:95527372-95527394 GAGCATATTGAATAAAGAATAGG - Intergenic
1087410407 11:97784351-97784373 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1087465252 11:98495704-98495726 TGGCGTCTTGAACAAAGAATTGG + Intergenic
1087995154 11:104797327-104797349 TGGCATTTTGAACAAAGAATTGG + Intergenic
1088087852 11:106003045-106003067 GGGCACCTTGAAAAAAGAACAGG + Intronic
1088102963 11:106175345-106175367 TGGCATCTTGAACAAAGAATTGG - Intergenic
1088346760 11:108835507-108835529 TGGCATTTTGAACAAAGAATTGG + Intronic
1088380589 11:109188272-109188294 GGGCACCTTGAAAAAAGAAAAGG - Intergenic
1088543839 11:110940238-110940260 TGGAATCTTAAAGAAATAATAGG - Intergenic
1088714786 11:112539470-112539492 TGGCATCTTGAACAAAGAATTGG + Intergenic
1088890518 11:114040786-114040808 TGGCAACTTAGACAAAAAATGGG + Intergenic
1088967293 11:114736540-114736562 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1089142414 11:116296595-116296617 TGGCGTCCTGCACAAAGAATTGG - Intergenic
1089593065 11:119557279-119557301 TGGCATTTTGAACAAAGAATTGG - Intergenic
1089858611 11:121569299-121569321 GGGCACCTTGAAAAAAGAACAGG + Intronic
1090100909 11:123796020-123796042 TGGGGTTTTGAACAAAGAATTGG + Intergenic
1090222832 11:125045634-125045656 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1090310501 11:125732518-125732540 TTACATATTGAAAAAAGAATGGG + Intergenic
1090343139 11:126043473-126043495 GGGCATTTTGAACAAAGGATTGG - Intronic
1091209790 11:133846253-133846275 TGGCGTCTTAAACAAAGAAATGG - Intergenic
1092414621 12:8280775-8280797 GGGCATCCTGAAAAAAGAACAGG - Intergenic
1092486580 12:8907478-8907500 TGGCATCTTGAACAAAGAATTGG + Intergenic
1092516366 12:9218484-9218506 TGGTGTCTTGAACAAAGAATTGG - Intergenic
1092549543 12:9483377-9483399 TTACATCTTGAACAAAGACAGGG + Intergenic
1092644386 12:10553465-10553487 TGGCATTTTGAACAAACAATTGG - Intergenic
1092655286 12:10677586-10677608 TGGCGTTTTGAACCAAGAATTGG + Intergenic
1092678227 12:10945998-10946020 GGGCACCTTGAAAAAAGAACAGG - Intronic
1092853473 12:12651564-12651586 TGACGTTTTGAACAAAGAATTGG + Intergenic
1092864684 12:12749869-12749891 TGGCGTTTTGAACAAATAATTGG - Intronic
1092914910 12:13180846-13180868 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1093062777 12:14624783-14624805 TGGCATATTGAACTAAGGCTAGG + Intronic
1093071768 12:14713260-14713282 TGGCATCTTGAACAAAGAATTGG - Intergenic
1093074772 12:14746353-14746375 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1093357094 12:18179147-18179169 TGGCATCTCGAACAAAGAATTGG - Intronic
1093824546 12:23667593-23667615 TGGGATCTTGAACAATTTATTGG - Intronic
1094027762 12:25976740-25976762 TGGCATTTTGAAAAAAGAACTGG - Intronic
1094159778 12:27378406-27378428 TTGGATTTTGAAGAAAGAATAGG + Intronic
1094287149 12:28808425-28808447 TGGTGTCTTAAACAAAGAATTGG + Intergenic
1094288496 12:28819561-28819583 TGGTGTTTTGAACAAACAATTGG + Intergenic
1094326793 12:29248964-29248986 GGGCACCTTGAAAAAAGAACAGG - Intronic
1094328734 12:29269402-29269424 AGGCACCTTGAAAAAAGAACAGG - Intronic
1094411702 12:30174003-30174025 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1094555450 12:31494973-31494995 TGGTGTCTGGAACAAAAAATTGG - Intronic
1094605425 12:31945033-31945055 TGGCATTTTAAACAAAGAATTGG + Intergenic
1095117596 12:38373713-38373735 TGGCATTTTGAAAAAAGAATTGG + Intergenic
1095166836 12:38983020-38983042 TGGTGTTTTGAACAAAAAATTGG + Intergenic
1095215070 12:39538529-39538551 TGGCGTCTTGAACAAAGAATTGG - Intergenic
1095240483 12:39853086-39853108 TGGCGTTTTGAGCAAAGAATTGG - Intronic
1095363518 12:41373603-41373625 GGGCATCTTGAAAAAAGAACAGG - Intronic
1095486693 12:42692455-42692477 TGGCATTTTGAACAAAGAATTGG - Intergenic
1095663532 12:44766488-44766510 TTGCATTTTGAAGTAAGAATAGG - Intronic
1095691193 12:45091083-45091105 TGGCATTTTAAAAAAATAATGGG + Intergenic
1095768191 12:45920511-45920533 TGGCATCTTGAAAGAACAGTAGG - Exonic
1095812498 12:46384924-46384946 TTGCATAGTGAACAAAGCATTGG - Intergenic
1096131338 12:49161241-49161263 TGGTGTCTTAAACAAAGATTTGG - Intergenic
1096289233 12:50326889-50326911 TGGCATTTTGAACAAAGAATTGG - Intronic
1096538813 12:52291690-52291712 TGACATCTTTTACAAAGAAGAGG - Intronic
1096943796 12:55381219-55381241 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1096948814 12:55441651-55441673 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1096970925 12:55665694-55665716 TGGCATCTTGAAGAAAGAATTGG + Intergenic
1097424076 12:59419966-59419988 TGGCATTTTGAACTAAGAATTGG - Intergenic
1097479164 12:60099589-60099611 TGGCATTTTGGACAAAGAATTGG + Intergenic
1097596393 12:61637440-61637462 TCGCATTTTGAACAAAGAATTGG - Intergenic
1097663956 12:62459765-62459787 TGGCATCTTGAACAAAGAATTGG + Intergenic
1097932191 12:65200424-65200446 TGGTGTTTTGAACAAAGAATTGG - Intronic
1098135471 12:67397288-67397310 TGGCATCTTGAACAAAGAATTGG + Intergenic
1098189537 12:67933643-67933665 TGGCATCTTAAAGATAGGATAGG - Intergenic
1098333804 12:69381400-69381422 GGGCACCTTGAAAAAAGAACAGG - Intronic
1098400818 12:70073708-70073730 TGGTGTTTTGAACAAAGAATTGG - Intergenic
1098459430 12:70715771-70715793 GGGCACCTTGAAGAAAGAACAGG - Intronic
1098543310 12:71683978-71684000 TGGTGTTTTGAACAAAGAACTGG + Intronic
1098695702 12:73551622-73551644 TGGCATCTTGAAGAAAGAACTGG + Intergenic
1098826957 12:75308530-75308552 TTGCACTTTGAACAAAGAATTGG - Intronic
1098827042 12:75309352-75309374 TGGTGTCCTGAACAAAGAACTGG - Intronic
1098960525 12:76735504-76735526 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1099084780 12:78232089-78232111 TGGCATCTTGAACAAAGAATTGG - Intergenic
1099117719 12:78648573-78648595 GGGCACCTTGAAAAAAGAATAGG + Intergenic
1099227836 12:79991068-79991090 TGGCGTTTTGAACAAAGAACTGG - Intergenic
1099398981 12:82178912-82178934 TGGCGTCTTGAACAAAGAGTTGG - Intergenic
1099555148 12:84101438-84101460 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1099556052 12:84109054-84109076 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1099570702 12:84314066-84314088 TGGAATCTCTAACAAATAATAGG + Intergenic
1099721359 12:86365302-86365324 GGGCACCTTGAAAAAAGAACAGG - Intronic
1100077454 12:90802845-90802867 TGGCATTTTGAACAAAGAATTGG + Intergenic
1100257341 12:92897641-92897663 TGGCGTTTTGAATAAAGAATTGG - Intronic
1100499071 12:95156145-95156167 GGGCACCTTGAAAAAAGAACAGG + Intronic
1100566646 12:95800867-95800889 TGGTGTCCTAAACAAAGAATTGG - Intergenic
1100572613 12:95857560-95857582 TGGCGTTTTCAACAAAGAATTGG - Intergenic
1100634373 12:96421130-96421152 TGGCATCTTGAACAAAGAATTGG + Intergenic
1100660999 12:96698776-96698798 TGGCGTTTTGAACAAAGAACTGG + Intronic
1101502092 12:105313720-105313742 GGGCACCTTGAAAAAAGAACAGG + Intronic
1102308049 12:111821442-111821464 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1102308870 12:111828384-111828406 TGGTGTCTTGAACAAAAAATTGG - Intergenic
1102418181 12:112782587-112782609 CAGGATCTTGAAGAAAGAATAGG + Intronic
1103218125 12:119219306-119219328 GGGCACCTTGAAAAAAGAACAGG - Intronic
1104309702 12:127643370-127643392 TGGCTTCTTAAACAAAGAATTGG - Intergenic
1105227698 13:18451707-18451729 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1105364979 13:19756352-19756374 TGGCGTCTTGAACAAAGAATTGG - Intronic
1105398983 13:20071318-20071340 TGGCGTTTTGAACAAAGGATTGG + Intronic
1105521601 13:21136014-21136036 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1105711865 13:23017995-23018017 AGGCACCTTGAAAAAAGAACAGG + Intergenic
1105995852 13:25671345-25671367 GGGCACCTTGAAAAAAGAACAGG + Intronic
1106008452 13:25794167-25794189 TTCCATCTTGAAGAAAGAAGAGG + Intronic
1106117158 13:26827735-26827757 TGACAAATTAAACAAAGAATTGG + Intergenic
1106598978 13:31171186-31171208 TGACATCTTGAACAAAGAATTGG - Intergenic
1106601604 13:31192313-31192335 TGGTGTTTTGAACAAAGAATTGG - Intergenic
1106610951 13:31280031-31280053 GGGCACCTTGAAAAAAGAACAGG - Intronic
1106763175 13:32887716-32887738 TGGTGTGTTGAGCAAAGAATTGG + Intergenic
1106841054 13:33685407-33685429 TCACAACTTGAACAAAGAATTGG - Intergenic
1106857485 13:33868802-33868824 TGATATTTTGAACAAGGAATTGG - Intronic
1107111308 13:36701037-36701059 TGGAGTCTTGAACAAAGAATTGG + Intergenic
1107273690 13:38652123-38652145 TTGTATCTTGAACAAAAAATGGG + Intergenic
1107407638 13:40129376-40129398 TGGCATCCTGAACAAAGAATTGG + Intergenic
1107520531 13:41176011-41176033 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1107522382 13:41195915-41195937 TGGCGTTTTGGACAAAAAATTGG - Intergenic
1107530503 13:41278263-41278285 TGGCGTCTCGAACAAAGAAATGG + Intergenic
1107568078 13:41627363-41627385 TGGTGTCTTGAACAAAGAATTGG - Intronic
1108020959 13:46127204-46127226 CCTCATCTTGAACAAAGAAAAGG + Exonic
1108180585 13:47836264-47836286 TGGTATTTTGAACAAAGAATTGG - Intergenic
1108356777 13:49635422-49635444 TTGCATTTTGAACAAAGAATTGG + Intergenic
1108467485 13:50731303-50731325 TGGCATTTTGAACCAAGAATTGG - Intronic
1109081188 13:57903376-57903398 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1109377751 13:61519650-61519672 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1109424340 13:62151547-62151569 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1109488359 13:63058409-63058431 TGGCGTTTTGAACAAAGAACCGG - Intergenic
1109510161 13:63361514-63361536 TGGCATCTTGAACAAAGAATTGG - Intergenic
1109783092 13:67138745-67138767 TGGTGTCTTGAACAAAGAATTGG - Intronic
1109830808 13:67785103-67785125 TGGCTTCTTGCACAAATAAATGG + Intergenic
1109897726 13:68715679-68715701 AGACATATTGAACAATGAATTGG - Intergenic
1109911932 13:68923572-68923594 GGGCACCTTGAAAAAAGAATAGG - Intergenic
1109928667 13:69183564-69183586 CGGCATCTTGAACAAAGAACTGG - Intergenic
1110245475 13:73318746-73318768 GGGAATTTTGAAAAAAGAATAGG - Intergenic
1110251285 13:73383464-73383486 TGGAATCTTGAACAAAGAATTGG - Intergenic
1110390583 13:74968778-74968800 TGGCATAGTGGAAAAAGAATAGG - Intergenic
1110418066 13:75273780-75273802 TGGTGTCTTGAACAAAGAATTGG + Intergenic
1110555616 13:76856094-76856116 TGGTGTCTTGAACAAAGAATTGG + Intergenic
1110574001 13:77035731-77035753 TGGTTTCTTGAACAAACAATTGG + Intergenic
1110896627 13:80760904-80760926 TGGTATTTTGAACAAAGAATTGG - Intergenic
1110925248 13:81142620-81142642 TGGCGCCTTGAACAAAGAACTGG - Intergenic
1111055485 13:82944031-82944053 TAGCGTTTTGAACAAAGTATTGG + Intergenic
1111105950 13:83645033-83645055 TGGGCTCTTGAACAAGCAATGGG - Intergenic
1111406109 13:87809667-87809689 TGGCATTTCTAACAAATAATTGG + Intergenic
1111429548 13:88133712-88133734 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1111468332 13:88645533-88645555 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1111509536 13:89242895-89242917 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1111515447 13:89325168-89325190 TGGCGTATTGAGCAAAGAATTGG - Intergenic
1111594765 13:90397049-90397071 CGGCATCTTGAACAAAGAATTGG - Intergenic
1111651858 13:91101078-91101100 TGCCATCCTGGATAAAGAATTGG - Intergenic
1111712166 13:91830332-91830354 GGGCACCTTGAAAAAAGAACAGG - Intronic
1111742391 13:92220002-92220024 TGGCAACTTGAACAAAGAATTGG - Intronic
1111745551 13:92264561-92264583 TGGTGTTTTGAACAAAGAATTGG - Intronic
1111936193 13:94559209-94559231 TGACGTCTTGAACAAAGAATTGG - Intergenic
1111940119 13:94599458-94599480 TGGCATTTTGAACAAAGAATTGG + Intergenic
1112093509 13:96107981-96108003 GGGCACCTTGAAAAAAGAACAGG + Intronic
1112370529 13:98789117-98789139 TGGTGTCTTGAACAAAGAATTGG - Intergenic
1112404273 13:99104365-99104387 TGGCGTTTTGAACAAAGAATTGG + Intergenic
1112448268 13:99486908-99486930 TGGCGTTTTGAACAAAGAATTGG + Intergenic
1112449562 13:99496504-99496526 TGGCGTTTTGAACAAATAATTGG + Intergenic
1112552607 13:100435662-100435684 TGGCGTTTTGAACAAAGAATTGG + Intronic
1112921255 13:104615418-104615440 TGGTGTTTTCAACAAAGAATTGG - Intergenic
1113059475 13:106306827-106306849 TGGCATTTTGAACAAAGAATTGG + Intergenic
1113290507 13:108900759-108900781 GGGCACCTTGAAAAAAGAACAGG + Intronic
1113312331 13:109142944-109142966 TGGCGTTTTGAACAAAGAATCGG - Intronic
1114339769 14:21730825-21730847 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1114355496 14:21903669-21903691 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1114687082 14:24543508-24543530 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1114787424 14:25616847-25616869 TGGTGTTTTGAACAAAGAATTGG - Intergenic
1114859220 14:26494380-26494402 TGACAACTTTAACAAAGAAGTGG - Intronic
1114860190 14:26508365-26508387 TAGCTTCTTGAAGAAAGAAAAGG + Intronic
1114919261 14:27306569-27306591 TGGTGTTGTGAACAAAGAATTGG - Intergenic
1114919883 14:27312882-27312904 TGATGTCGTGAACAAAGAATTGG - Intergenic
1115002065 14:28435023-28435045 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1115531599 14:34333213-34333235 TGGCATTTTGAACAAAGAATTGG - Intronic
1115543125 14:34441513-34441535 TGGCGTTATGAACAAAGAATTGG - Intronic
1115544027 14:34448735-34448757 TGGCATCTTGAACAAAGAATTGG - Intronic
1116237506 14:42297697-42297719 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1116301822 14:43192721-43192743 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1116344193 14:43769181-43769203 TGGCATTTTGAACAAATAATTGG - Intergenic
1116397304 14:44462117-44462139 TGGCATCTTAAACAAAGAATTGG - Intergenic
1116576364 14:46581290-46581312 TGGCGTCTTGAACAAAGAATTGG + Intergenic
1116577178 14:46588759-46588781 TGGTGTCTTGAAGAAAGAATTGG + Intergenic
1116991016 14:51276601-51276623 TGGTGTCTTGAACAAAGAATTGG + Intergenic
1117135879 14:52733773-52733795 TGGCGTTTTGAACAAAGAATTGG + Intronic
1117276384 14:54198278-54198300 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1117415808 14:55494504-55494526 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1117917059 14:60688850-60688872 TGGCGTTTTGAACAAAGAATTGG - Intergenic
1118116395 14:62781742-62781764 GGGCACCTTGAAAAAAGAACAGG - Intronic
1118372229 14:65147052-65147074 GGGCACCTTGAAAAAAGAAGAGG - Intergenic
1118450964 14:65901872-65901894 TGGCATTTTGAACAAAGAATTGG - Intergenic
1118779589 14:68998331-68998353 TGGCTTCTAAAACAAAGAAGAGG + Intergenic
1119154327 14:72394674-72394696 GGGCACCTTGAAAAAAGAACAGG - Intronic
1119573221 14:75694984-75695006 GGGCACCTTGAAAAAAGAACAGG + Intronic
1119676748 14:76561511-76561533 TGGCTTCTTGAACAAAGAATTGG + Intergenic
1119959872 14:78842922-78842944 GGGCACCTTGAAAAAAGAACAGG - Intronic
1120203408 14:81562732-81562754 TAGAATCTTTAACAAAGCATTGG - Intergenic
1120286967 14:82515322-82515344 TGGCATTTTCAACAAAGAATTGG - Intergenic
1120295352 14:82633600-82633622 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1120807252 14:88766201-88766223 GGGCACCTTGAAAAAAGAACAGG + Intronic
1120820540 14:88907857-88907879 GGGCATTTTGAACAAAGAGTTGG - Intergenic
1121267912 14:92616198-92616220 TGGTGTCTTGAACAGAGAATTGG + Intronic
1121429396 14:93876365-93876387 TGGCATTTTGAACAAAGAATCGG - Intergenic
1121435498 14:93916494-93916516 TGGCATTTTGAACAAAGAATTGG + Intergenic
1121574269 14:94970411-94970433 TGGCATCTGGACAAAGGAATGGG + Intergenic
1121651662 14:95563362-95563384 TGGCATTTTGAGCAAAGAATTGG - Intergenic
1121653487 14:95576922-95576944 TGGCGTCTTGAACAAATAATTGG + Intergenic
1121991295 14:98560238-98560260 TGGCATTTTAAACAAAGAATTGG - Intergenic
1122182673 14:99967389-99967411 TCGCATCTTGAACAAAGAACTGG - Intergenic
1122439636 14:101721494-101721516 TGGTGTCTTGAACAAAGAAGTGG - Intergenic
1122547353 14:102531322-102531344 TGGTGTCTTGAACAAAGAATTGG - Intergenic
1122632837 14:103115113-103115135 TGGCGTTTTGAACAAAGAATTGG + Intergenic
1122654280 14:103246961-103246983 CGGTGTCTTGAACAAAGAAGTGG - Intergenic
1122739359 14:103862391-103862413 TGGCGTTTTGAACAAAGAATTGG + Intergenic
1123690409 15:22833867-22833889 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1123820950 15:24030156-24030178 TTGTGTCTTGAACAAAGAATTGG + Intergenic
1123821185 15:24031800-24031822 TGGCGTTTTGAGCAAAGAATTGG + Intergenic
1123849083 15:24335387-24335409 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1123864640 15:24505691-24505713 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1123868142 15:24542899-24542921 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1123931618 15:25174567-25174589 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1124095083 15:26641783-26641805 TGGCATCAGGAATAAAGAACAGG + Intronic
1124248240 15:28089205-28089227 GGGCACCTTGAAAAAAGAACAGG - Intronic
1125407779 15:39370953-39370975 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1125555744 15:40583263-40583285 TGGCATTTTGAACAAAGAATAGG - Intergenic
1125567353 15:40686776-40686798 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1125630483 15:41143104-41143126 TGGCATCTCAAACAAAGAATTGG + Intergenic
1125918101 15:43507438-43507460 TGGCATATTGAACAAAGAATTGG - Intronic
1126183936 15:45812097-45812119 TGGCGTCTTGCACAAAAAATTGG + Intergenic
1126242741 15:46464355-46464377 TGGCATTTGGAACAAAGAATTGG - Intergenic
1126276205 15:46884270-46884292 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1126724088 15:51613087-51613109 GGGCACCTTGAAAAAAGAACAGG - Intronic
1126728715 15:51659020-51659042 TGGTGTTTTGAACAAGGAATTGG - Intergenic
1126930322 15:53641234-53641256 TGCCATCTTTAACAAAGAGTAGG + Intronic
1127072339 15:55298949-55298971 GGGCACCTTGAAAAAAGAACAGG - Intronic
1127082465 15:55394017-55394039 TGGCATCTTGAACAAAGAACTGG - Intronic
1127147931 15:56044020-56044042 TGGCATCTTCCACAAAGAATTGG - Intergenic
1127755139 15:62084772-62084794 GGGCATCTTGAAAAAAGAACAGG - Intergenic
1127773656 15:62249725-62249747 TGACGTCTTGAACAAAGAACTGG - Intergenic
1127775517 15:62261458-62261480 TGGAATTTTGAACAAAGAATTGG - Intergenic
1127796975 15:62447130-62447152 AGGCTTCTTGAACAAAGTCTGGG - Intronic
1127891769 15:63258526-63258548 TGGCATTTTGAGCAAAGAATTGG + Intronic
1127903924 15:63361948-63361970 TGGTAGCTTAAACAAAGAAAAGG - Intronic
1127988971 15:64096907-64096929 TGGCATTTTGAACAAATAATTGG + Intronic
1128076162 15:64827079-64827101 TGGCGTTTTGAACAAAGAATTGG + Intergenic
1128283650 15:66417984-66418006 TGGCATCTTCAACAAAGAATTGG + Intronic
1128805189 15:70525620-70525642 TGGTGTCTTGAACAAAGAATTGG - Intergenic
1129004780 15:72363402-72363424 TGGGATCTTGAACCCTGAATTGG + Intronic
1129040716 15:72684100-72684122 TGGTGTCTTGAAAAAAGAATTGG + Intronic
1129200654 15:73996921-73996943 TGGCATTTTGAACAAAGAATTGG + Intronic
1129260482 15:74364640-74364662 TGGCGTCTTGAACAAAGAATTGG - Intronic
1129386431 15:75198656-75198678 TGGTGTTTTGAACAAAGAATTGG + Intronic
1129506565 15:76086457-76086479 TGGTGTCTTGAACAAAGAATTGG + Intronic
1129638715 15:77351681-77351703 TGGCACCTTGAACAAAGAATTGG - Intronic
1129969212 15:79762453-79762475 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1129981436 15:79874895-79874917 GGGCACCTTGAAAAAAGAACAGG - Intronic
1130193751 15:81760395-81760417 TGGCATCTTGAACAAAGAATTGG - Intergenic
1130306685 15:82716543-82716565 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1130312068 15:82764807-82764829 TGGCGTTCTGAACAAAGAATTGG - Intronic
1131070529 15:89462920-89462942 TGGCTTTTTGAACAAAGAATTGG - Intergenic
1131294108 15:91132050-91132072 TGGTGTTTTGAACAAAGAATGGG + Intronic
1131325721 15:91442157-91442179 TGGCGTCTTGAACAAAGAACTGG + Intergenic
1131589658 15:93734946-93734968 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1131808147 15:96144780-96144802 TTGCCACTTGAAGAAAGAATTGG + Intergenic
1132213675 15:100046868-100046890 GGGCACCTTGAAAAAAGAACAGG + Intronic
1132226526 15:100146579-100146601 GGGCACCTTGAAAAAAGAACAGG + Intronic
1133075163 16:3274507-3274529 TGGCATTTTGAACAAAGAACTGG + Intronic
1133099028 16:3467841-3467863 TGACATCTTGAACAAAGAATTGG + Intronic
1133177631 16:4027291-4027313 TGGCATTTTGAACAAAGAATTGG - Intronic
1133658491 16:7890800-7890822 TGACATCTTGACCAAAGAATTGG + Intergenic
1133679625 16:8108816-8108838 TGGCATTTTGAACAAAGAATTGG + Intergenic
1133694602 16:8249885-8249907 TGGCATTTTGAACAAAGAATTGG + Intergenic
1133998770 16:10766638-10766660 TGGTGTCTGGAACAAAAAATTGG + Intronic
1134151669 16:11810206-11810228 TGACGTTTTGAAAAAAGAATTGG + Intergenic
1134280400 16:12811904-12811926 TGGCATCTTGAACAAAGAATTGG + Intergenic
1134606512 16:15575551-15575573 TGGTGTTTTGAACAAAGAATTGG + Intronic
1134854770 16:17509175-17509197 TGGTGTCTTGATCAAATAATTGG - Intergenic
1135408396 16:22214823-22214845 TGGCATTTTGAGCAAAGAATTGG + Intronic
1135788669 16:25373537-25373559 TGGTGTCTTGAACAAAGAACTGG + Intergenic
1135813545 16:25611295-25611317 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1136595463 16:31246069-31246091 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1136635234 16:31517087-31517109 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1136642638 16:31579657-31579679 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1137240268 16:46649978-46650000 TGGCGTCTTGAACAAAGAATTGG + Intergenic
1137260049 16:46819178-46819200 TGGTGTCTTGAACAAAGAATTGG - Intronic
1137283023 16:46994001-46994023 TGGCGTTTTGAAGAAAGAATTGG - Intergenic
1137364115 16:47845868-47845890 TAGCATGTTGTACAAAGAACTGG - Intergenic
1137635940 16:49986501-49986523 TGGCATTTTGAACAAAGAATTGG + Intergenic
1137802287 16:51272354-51272376 TGGCGTTTTGAACAAAAAATTGG + Intergenic
1137845275 16:51681664-51681686 TGGAGTTTTGAACAAAGAATTGG - Intergenic
1138129212 16:54465147-54465169 TGGCGTTTTAAACAAAGAATTGG + Intergenic
1138521370 16:57573123-57573145 TGGCGTCTTGAACCAAGAATTGG + Intronic
1138767559 16:59622640-59622662 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1138767862 16:59625526-59625548 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1138851280 16:60632741-60632763 TGGGATTTTGAACAAAGAATTGG + Intergenic
1139000910 16:62508615-62508637 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1139498024 16:67335437-67335459 GGGCACCTTGAAAAAAGAACAGG - Intronic
1139614256 16:68079535-68079557 TGGAATCTGGAAGAAAGACTAGG + Intergenic
1140115045 16:72034632-72034654 TGGAGTCTTGAACAAAGAATTGG - Intergenic
1140266919 16:73428951-73428973 TGGCCTCGTGAAGGAAGAATGGG - Intergenic
1140404836 16:74701996-74702018 TGGCATCTTGAACAAAGAAATGG - Intergenic
1140507090 16:75480363-75480385 TGTGATCTTGAACAAAATATTGG + Intronic
1140565509 16:76036803-76036825 TGACATTTTGAACAAAGAATTGG + Intergenic
1140642029 16:76986355-76986377 TGGCATTTTAAACAAAGAACTGG + Intergenic
1140830227 16:78744017-78744039 TGGCGTTTTGAATAAAGAATTGG - Intronic
1140847338 16:78903002-78903024 TGGCATTTTGAAGAAATAGTTGG + Intronic
1141023529 16:80521231-80521253 TGGTCTCTTGGCCAAAGAATGGG - Intergenic
1141978764 16:87536255-87536277 TGGCATCTTGAACAAATAAATGG + Intergenic
1142447133 16:90148093-90148115 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1142460359 17:87238-87260 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1142649106 17:1335187-1335209 TGGCGTCTTGAACAAGGAACTGG - Intergenic
1143436970 17:6936375-6936397 TGGCGTTTTGAACAAAGAACTGG + Intronic
1143437542 17:6940306-6940328 TGGCGTTTTGAACTGAGAATTGG + Intronic
1143940968 17:10541134-10541156 GGGCACCTTGAAAAAAGAACAGG + Intronic
1144306055 17:13970518-13970540 TTGCATTTTGAACAAAGAATCGG - Intergenic
1145225557 17:21125196-21125218 TGGCGTTTTGAACAAACAATTGG + Intronic
1145292395 17:21558871-21558893 GGGCACCTTGAAAAAAGAACAGG + Intronic
1145354465 17:22128780-22128802 TGGTATTTTGAACAAAGAACTGG + Intergenic
1145387565 17:22427035-22427057 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1145819688 17:27822519-27822541 GGGCACCTTGAAAAAAGAACAGG - Intronic
1146038563 17:29430113-29430135 TGGCGTTTTGGACAAAGAATTGG + Intronic
1146527767 17:33581484-33581506 TGGCGTTTTGAACAAAGACTTGG + Intronic
1146745187 17:35322383-35322405 TGGTGTTTTGAACAAATAATTGG - Intergenic
1146755960 17:35432239-35432261 TGGCGTGTTGAACAAAGAACTGG + Exonic
1146992716 17:37289732-37289754 TTGCATTTTGAAGAATGAATTGG - Intronic
1147058913 17:37858343-37858365 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1147591353 17:41685680-41685702 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1148619009 17:49020797-49020819 TGGCATATTGAACATTGACTAGG + Intronic
1148974242 17:51512796-51512818 TGGCATTTTGAACAAAGAATTGG - Intergenic
1149068463 17:52509142-52509164 TGGTATATTTAACAAATAATTGG - Intergenic
1149254141 17:54805650-54805672 TGGCGTCTTAAACAAAGAATTGG - Intergenic
1149271248 17:54980398-54980420 TGGCAATTTGAACAAAGATTTGG + Intronic
1149289063 17:55197924-55197946 TGGAGTTTTAAACAAAGAATTGG + Intergenic
1149316562 17:55444270-55444292 TGGCGTTTTGAACAAAGAACTGG + Intergenic
1149476262 17:56963548-56963570 TGGCATCTTGAACAGAGAATTGG - Intergenic
1150344387 17:64393129-64393151 TGGTGCCATGAACAAAGAATTGG - Intronic
1150553850 17:66235956-66235978 TGGTATTTTTAACAAACAATTGG - Intronic
1151091154 17:71441409-71441431 TGGGATCATTAACAAATAATTGG - Intergenic
1151135017 17:71938192-71938214 TGGCTTCTAGAACAAAGTTTTGG - Intergenic
1151783150 17:76261000-76261022 TGGCATCTTGAAGAAACAATAGG + Intergenic
1151864719 17:76793478-76793500 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1152833140 17:82511309-82511331 TGGCGTTTTGAACAAAGAATCGG + Intergenic
1152995424 18:402079-402101 TGGTGTTTTGAACAAAGAATTGG + Intronic
1153168780 18:2292186-2292208 TGGCATCTTGAAGAAAGAATTGG - Intergenic
1153174731 18:2357917-2357939 TGGCGTCTTGAACAAATAATTGG - Intergenic
1153261740 18:3230860-3230882 TGGCATCATGAACAAAGAATTGG - Intergenic
1153378206 18:4405857-4405879 TTGCGTTTTGAACAAAGAATTGG + Intronic
1153485541 18:5593942-5593964 GGGCACCTTGAAAAAAGAACAGG - Intronic
1153538514 18:6129743-6129765 TTGCATTTTGATCAAAGAGTAGG + Intronic
1153563722 18:6398425-6398447 TGGCATTTTGAACCCAGGATGGG - Intronic
1153721683 18:7910322-7910344 TGGTGTCTTGAACAAAGAATTGG + Intronic
1153800618 18:8665158-8665180 AGGCATTTCGAACAAAGAATTGG + Intergenic
1153832173 18:8933559-8933581 TGGCATCTTGAACAAAGAATTGG - Intergenic
1153960585 18:10136726-10136748 TGGTATTTTGAACAGAGAATTGG - Intergenic
1154113077 18:11586997-11587019 TGGCATCTTGAACAAAGAATTGG - Intergenic
1154294708 18:13137902-13137924 TGGCGTTTTGAACAAAGAATTGG + Intergenic
1154525684 18:15287769-15287791 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1155342994 18:24831583-24831605 TGGCATCCTGTACAAAGTGTTGG + Intergenic
1155450502 18:25958384-25958406 TGGCGTTTTAAACAAAGAATTGG + Intergenic
1155462966 18:26104066-26104088 TGGTGTGTTGGACAAAGAATTGG - Intergenic
1155797703 18:30060513-30060535 TGGTGTTTTGAACAAATAATTGG + Intergenic
1155803267 18:30135845-30135867 CGGCATCTTGAACAAAGAATTGG + Intergenic
1156198552 18:34804154-34804176 TGGCATCTTGACAAATGGATGGG + Intronic
1156203407 18:34859250-34859272 TGGCATTTTGAATAAAGAATTGG + Intronic
1156238368 18:35227099-35227121 TGGCGTCTTGAACAAAGAATTGG + Intergenic
1156761492 18:40596714-40596736 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1156849303 18:41707749-41707771 TGGCATCTTAAACAAATAAATGG + Intergenic
1157013738 18:43683301-43683323 TCACATCTTGAACAAATAATTGG + Intergenic
1157212774 18:45758220-45758242 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1157342226 18:46789496-46789518 TGGCATCTTGAAGAAAGAATTGG - Intergenic
1157467620 18:47960956-47960978 GGGCACCTTGAAAAAAGAATAGG + Intergenic
1157593525 18:48850329-48850351 CGGCATCTTGAACAGTGACTTGG - Intronic
1157673921 18:49553970-49553992 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1157726648 18:49969589-49969611 TGGCGTCTTGAACAAAGAATTGG - Intronic
1157775966 18:50396603-50396625 TGGCATCTTGAACAAAGAATTGG - Intergenic
1158042746 18:53116158-53116180 TGGCCACTTGAACAAAGAATTGG + Intronic
1158112985 18:53962606-53962628 GGGCACCTTGAAAAAAGAAAAGG + Intergenic
1158266631 18:55666285-55666307 TGGAGTCTTGAACAAAGAATTGG - Intergenic
1158344958 18:56506963-56506985 TGGCGTCTTAAACAAAGAATTGG - Intergenic
1158597436 18:58828402-58828424 TGGCGTTTTGAACAGAGAATTGG - Intergenic
1158679905 18:59557838-59557860 TGGTGTTTTGAACAAAGAATTGG - Intronic
1158847637 18:61461615-61461637 TGGCATTTTGAACAAATAATTGG + Intronic
1159074528 18:63665633-63665655 GGGCACCTTGAAAAAAGAACAGG + Intronic
1159079062 18:63714725-63714747 GGGCAACTTGAAAAAAGAACAGG - Intronic
1159208023 18:65279268-65279290 TGACATTTTGAACGAAAAATTGG + Intergenic
1159266928 18:66093149-66093171 TGTCATTTTGAACAAAGAATTGG - Intergenic
1159280107 18:66274238-66274260 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1159604052 18:70456822-70456844 TGGCGTCTTGAACAAAGAATTGG - Intergenic
1159686161 18:71423621-71423643 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1159850207 18:73517683-73517705 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1160054975 18:75470579-75470601 TGGCATCTTCACAAAAGAAAAGG + Intergenic
1160249274 18:77186746-77186768 AGGCACCTTGAAAAAAGAACAGG - Intergenic
1160650074 19:219738-219760 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1160654972 19:261321-261343 TGGCATCTTGAACAAAGAATTGG - Intergenic
1160737277 19:669225-669247 AAACATCTTGAACAAAAAATAGG - Intergenic
1162208593 19:9074383-9074405 TGGCATCCCAAACAAAGAATTGG + Intergenic
1162275327 19:9649336-9649358 GGGCACCTTGAAAAAAGAACAGG + Intronic
1162657055 19:12139387-12139409 TGGCGTCTTGAACAAAGAATTGG - Intronic
1163590625 19:18192244-18192266 TGGCATCTTGAACAAAGAATTGG - Intergenic
1164270277 19:23666614-23666636 TGGCCTTTTGAACAAAGAATTGG - Intronic
1164332895 19:24277675-24277697 GGGCACCTTGAAGAAAGAACAGG + Intergenic
1164377762 19:27704161-27704183 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1164457679 19:28421937-28421959 TGGCATTTTGAACAAAGAATTGG + Intergenic
1164549652 19:29198524-29198546 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1164611805 19:29637390-29637412 TGACATCCTTAACAAAAAATGGG + Intergenic
1164655504 19:29918208-29918230 TGGTGCCTTGAACAAGGAATTGG - Intergenic
1165066191 19:33229948-33229970 GGGCGACTTGAACAAAGAATTGG + Intergenic
1165111110 19:33502881-33502903 TGCCATTTTGAACAAAGAATTGG - Intronic
1165122803 19:33572792-33572814 TGGCATTTTGAACAAAGAATTGG + Intergenic
1165233484 19:34402437-34402459 TGGAATATTGAACAAAGAGGTGG - Intronic
1165266776 19:34667711-34667733 TGCTGTTTTGAACAAAGAATTGG - Intronic
1165533551 19:36423863-36423885 TGATGTTTTGAACAAAGAATTGG + Intergenic
1165665377 19:37623058-37623080 GGGCACCTTGAAAAAACAATAGG + Intronic
1165841984 19:38793655-38793677 TGGTCTCTTGAATGAAGAATTGG - Intergenic
1165997957 19:39858504-39858526 GGGCGTTTTGAACAAAGAACTGG + Intergenic
1166566720 19:43770051-43770073 TGGCCTCTTGAATGAAGGATAGG + Intronic
1166632575 19:44420170-44420192 GGGCACCTTGAAAAAAGAACAGG + Intronic
1166713158 19:44950003-44950025 TGGCGTCCTGAACAAAGAACTGG + Intergenic
1166953048 19:46443086-46443108 TGGTGTTTTGAACAAAGAATTGG - Intergenic
1167715497 19:51140517-51140539 TGGTGTCTTAAACAAAGAATTGG - Intergenic
1167799586 19:51731451-51731473 GGGCACCTTGAAAAAAGAACGGG - Intergenic
1167834853 19:52060171-52060193 TGGCATTTTGAACAAAGACTTGG - Intronic
1167987056 19:53327528-53327550 TCGTGTCTTGAACAAAGAATTGG + Intergenic
1168214576 19:54916157-54916179 TGGTGTTTCGAACAAAGAATTGG - Intergenic
1168672153 19:58248712-58248734 TGGCATTTTGAACAAAGAATTGG + Intronic
1168673214 19:58257227-58257249 TGGCATTTTTAACAAAGAATTGG + Intronic
1168682462 19:58326156-58326178 TGGCATCTTGAACAAATAATTGG + Intergenic
924973464 2:152469-152491 TGGCATCTTGAAGCAAGAATTGG - Intergenic
925372534 2:3357278-3357300 TGGCATCTTGAGCAAAGAACTGG - Intronic
926212291 2:10880095-10880117 TGGCTTTTTGAACGAAGAATTGG - Intergenic
926556353 2:14362601-14362623 AGGCACCTTGAAAAAAGAACAGG - Intergenic
926859152 2:17290708-17290730 GGGCACCTTGAAAAAAGAACAGG - Intergenic
926859980 2:17299539-17299561 TGGCAGCTTGACCAAAGGAATGG - Intergenic
927195768 2:20545458-20545480 GGGCACCTTGAAAAAAGAACAGG - Intergenic
928308209 2:30188717-30188739 TGGCGTCTCAAACAAATAATTGG - Intergenic
928503969 2:31929561-31929583 TAGCAGCTTGGAAAAAGAATTGG - Intronic
928708332 2:33976557-33976579 GGGCACCTTGAAAAAAGAATAGG + Intergenic
928901541 2:36323540-36323562 GGGCACCTTGAAAAAAGAACAGG + Intergenic
928965214 2:36968892-36968914 TGAAATCTTGAACAAAGAATTGG - Intronic
928978735 2:37116733-37116755 TTGCAACTTGAACATAGCATAGG - Intronic
929336023 2:40746594-40746616 TGGCATTTTGAACAAAGAATTGG - Intergenic
929342922 2:40844727-40844749 TGGAGTTTTGAACAAAGAATTGG - Intergenic
929362019 2:41103196-41103218 TCGCATCTTCAACAAAGAACAGG - Intergenic
929608908 2:43255254-43255276 AGGCACCTTGAACAAAGAGTAGG - Intronic
929711382 2:44270459-44270481 TGGCGTTTTGAACAAAGAATTGG + Intergenic
929772313 2:44902708-44902730 TGGCGTTTTAAACAAAGAATTGG + Intergenic
930142395 2:47965535-47965557 TGGTGTTTTGAACAAAGAATTGG - Intergenic
930496043 2:52144907-52144929 TGGCGTTTTGAACAAAGAATTGG - Intergenic
930595940 2:53387920-53387942 GGGCACCTTGAAAAAAGAACAGG - Intergenic
930643456 2:53878420-53878442 GGGCACCTTGAAAAAAGAACAGG + Intronic
930877917 2:56240517-56240539 TGGCATTTTGAACAAAGAATTGG - Intronic
931274475 2:60732572-60732594 TGGCGTCTTGAACAAAGAATTGG + Intergenic
931342448 2:61414609-61414631 TGGCGCTTTGAACAAAGAATAGG + Intronic
931470523 2:62534267-62534289 GGGCACCTTGAAAAAAGAACAGG - Intergenic
931562177 2:63573661-63573683 GGGCACCTTGAAAAAAGAACAGG + Intronic
931583948 2:63806861-63806883 GGGCACCTTGAAAAAAGAATAGG - Intronic
931600323 2:63996482-63996504 GGGCACCTTGAAAAAAGAACAGG + Intronic
932259395 2:70314369-70314391 TGGCATCTTGAACAAAGAATTGG - Intergenic
932358303 2:71085013-71085035 TGGCATCTGGAACAAAGAATTGG - Intergenic
932489519 2:72111681-72111703 GGGCACCTTGAAAAAAGAACAGG + Intergenic
932692459 2:73924956-73924978 TGACATTTTGAACAAAGAATTGG + Intergenic
932881734 2:75508201-75508223 GGGCACCTTGAAAAAAGAACAGG + Intronic
932942014 2:76177849-76177871 GGGCACCTTGAAAAAAGAACAGG - Intergenic
933079788 2:77971717-77971739 TGGTGTTTTGAACAGAGAATTGG + Intergenic
933333056 2:80919739-80919761 GGGCACCTTGAAAAAAGAACAGG + Intergenic
933459936 2:82569767-82569789 GGGCACCTTGAAAAAAGAACAGG + Intergenic
933660691 2:84925233-84925255 TGGCAGTTTGAACAAAGGATTGG - Intergenic
933792520 2:85894465-85894487 TGGCGTTTTGAACAAAGAATTGG + Intergenic
934818549 2:97351849-97351871 TGGCATTTTGAGCAAAGAATTGG - Intergenic
934899697 2:98149270-98149292 TGGCATTTTGAAGAAAGAATTGG + Intronic
934929940 2:98414085-98414107 GGGCACCTTGAAAAAAGAACAGG + Intergenic
934932171 2:98435584-98435606 GGGCACCTTGAAAAAAGAACAGG + Intergenic
935142147 2:100362689-100362711 GGGCACCTTGAAAAAAGAACAGG - Intergenic
935309235 2:101766812-101766834 TGGCACTTTGAACAAAGATTTGG + Intronic
935323219 2:101908403-101908425 TGGCATTTTTAACAAAGAATTGG - Intergenic
935724226 2:106008908-106008930 TGGCATTTTTAACAAAGAATTGG + Intergenic
935884991 2:107608016-107608038 TGGCATCTTGAACAAAGAATTGG - Intergenic
936160738 2:110082533-110082555 GGGCACCTTGAAAAAAGAACAGG + Intergenic
936183926 2:110288821-110288843 GGGCACCTTGAAAAAAGAACAGG - Intergenic
936686805 2:114836991-114837013 GGGCACCTTGAAAAAAGAACAGG - Intronic
936801269 2:116269293-116269315 TGGCATTTTGAACAAAGAATTGG - Intergenic
936874212 2:117168516-117168538 GGGCACCTTGAAAAAAGAACAGG - Intergenic
937019667 2:118638923-118638945 TGGCGTTTTGAACGAAGAACTGG - Intergenic
937140711 2:119597584-119597606 TGGCGTTTTGAACAAGGAATTGG + Intronic
938236179 2:129708825-129708847 TGGCATTTTGAACAAAGAATTGG + Intergenic
938308764 2:130271412-130271434 GGGCACCTTGAAAAAAGAACAGG - Intergenic
938858518 2:135341528-135341550 GGGCACCTTGAAAAAAGAACAGG + Intronic
938872768 2:135498552-135498574 GGGCACCTTGAAAAAAGAACAGG + Intronic
938959071 2:136324549-136324571 TGGCATCTTGAACAAAGAATTGG - Intergenic
939246144 2:139625785-139625807 GGGCACCTTGAAAAAAGAACAGG - Intergenic
939491353 2:142881053-142881075 AGGCCTCTTGAAAAAAGCATTGG + Intronic
939796866 2:146655962-146655984 GGGCACCTTGAAAAAAGAACAGG - Intergenic
940212447 2:151269337-151269359 TGGCATCTAAAACAAACAAAAGG - Intergenic
940296177 2:152127225-152127247 TAGCATTTTGAACAAAGAATTGG - Intronic
940494102 2:154403520-154403542 TGCCATCTTAAACAAATAAGAGG - Intronic
940504475 2:154535396-154535418 TGGGGTCTTGATCAAAGAACTGG - Intergenic
940569445 2:155411373-155411395 TGGCGTCCTGAACAAAGAATTGG - Intergenic
940707973 2:157127278-157127300 TGGTGTCTTGAACAAAGAATTGG - Intergenic
941250963 2:163162007-163162029 TGGAGTTTTGAACAAAGAATTGG + Intergenic
941541719 2:166794268-166794290 TAGCATTTCGAACAAAGAATTGG + Intergenic
941542172 2:166800510-166800532 TAGCATTTTGAACAGAGAATTGG + Intergenic
941990673 2:171553860-171553882 TGGCGTTTTGAACAAAGAAGTGG + Intronic
942016983 2:171827725-171827747 TGGCATATTGAACAAAGAATTGG - Intronic
942132485 2:172893969-172893991 TAGCATCTTTACCAAAGATTTGG - Intronic
942191075 2:173470963-173470985 TTGCACCTTGAAAAAAGGATAGG + Intergenic
942380776 2:175387989-175388011 GGGCATCTTGAAAAAAGAACAGG + Intergenic
942418979 2:175788027-175788049 TGGCATCTGGAACCAGGAAGAGG + Intergenic
942478336 2:176353405-176353427 GGGCACCTTGAAAAAAGAACAGG - Intergenic
942756133 2:179343679-179343701 TGGCGTCTTGAGCAAAGAATTGG + Intergenic
942917894 2:181334417-181334439 TGGCTTCTTAAACAAAGAATTGG + Intergenic
943066417 2:183091297-183091319 TGGCATTTTGAACAAATAATTGG + Intronic
943502645 2:188711383-188711405 GGGCACCTTGAAAAAAGAACAGG + Intergenic
943743541 2:191437382-191437404 TAGTGTCTTGAACAAAGAATTGG + Intergenic
943750756 2:191507229-191507251 GGGCACCTTGAAAAAAGAACAGG + Intergenic
944151232 2:196560982-196561004 GGGCACCTTGAAAAAAGAATAGG + Intronic
944178587 2:196862015-196862037 GGGCACCTTGAAAAAAGAACAGG + Intronic
944214346 2:197239121-197239143 AGGCATCAGGAAGAAAGAATGGG + Intronic
944485807 2:200203985-200204007 CGGCATCTTGAACAAAGAACTGG - Intergenic
944780037 2:203008349-203008371 GGGCACCTTGAAAAAAGAACAGG + Intronic
944895477 2:204159513-204159535 TGGCATCTTGACCAAGGAAGGGG - Intergenic
945063790 2:205931301-205931323 TGGCATCTTGAACAAAGAGTTGG + Intergenic
945314589 2:208358852-208358874 TGGCGTTTTGAACAAAGAATTGG + Intergenic
945371057 2:209018546-209018568 GGGCACCTTGAAAAAAGAACAGG + Intergenic
945386134 2:209203198-209203220 GGGCACCTTGAAAAAAGAACAGG - Intergenic
945504177 2:210617808-210617830 TGGCATCATAAACCAAGAAAGGG - Intronic
945536577 2:211025517-211025539 GGGCAGCTTGAAAAAAGAACAGG - Intergenic
945593764 2:211767186-211767208 TGGTGTTTTGAACAAAGAATTGG - Intronic
945897180 2:215497076-215497098 GGGCACCTTGAAAAAAGAACAGG + Intergenic
946074255 2:217060995-217061017 TGGCGTCTTGCAAAAAGAACTGG + Intergenic
946101631 2:217330198-217330220 TGGCATTTTAAACAAAGAACTGG + Intronic
946119681 2:217498965-217498987 TGGCGTTTTGAACAAAGAATTGG - Intronic
947216111 2:227751647-227751669 TGTCATTTTGAACAAAGAACTGG + Intergenic
947270468 2:228328382-228328404 GGGCACCTTGAAAAAAGAACAGG - Intergenic
947472736 2:230413342-230413364 TGGCGTTTTGAACAAAGAATTGG + Intergenic
947497797 2:230651287-230651309 TGGCGTCTTGAACAAAGAATTGG + Intergenic
947498266 2:230654443-230654465 TGGCATTTTGAACAATGAATTGG + Intergenic
947539982 2:230969731-230969753 TGGCATTTTGAACAAAGAGTTGG - Intergenic
947719540 2:232362098-232362120 TGGCCTATTGAACAAAGAATTGG - Intergenic
947961666 2:234243890-234243912 TGGGGTTTTGAACAAAGAATCGG + Intergenic
948007543 2:234622749-234622771 TGGCGTCTCAAACAAAGAAATGG - Intergenic
948075429 2:235162015-235162037 TGGCATTTTGAACAAATAATTGG + Intergenic
948272306 2:236683874-236683896 TGGCGTTTTGAACAAAGATTTGG + Intergenic
948289106 2:236811559-236811581 TGGCATTTTGAACAAAGAATTGG - Intergenic
948633932 2:239321902-239321924 TGACATGTTGAACAAAGAATTGG + Intronic
948827928 2:240582709-240582731 TGGCGTCTTAAATAAAGAATTGG + Intergenic
1168898978 20:1343775-1343797 TGGCGTCTTGAACAAATAATTGG + Intronic
1169115430 20:3062087-3062109 AGGCATCATGAACAAACACTGGG + Intergenic
1169280744 20:4264842-4264864 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1169374259 20:5053863-5053885 GGGCACCTTGAAGAAAGAACAGG + Intergenic
1169510578 20:6259671-6259693 TGGTGTATTGAACCAAGAATCGG + Intergenic
1169537489 20:6560849-6560871 TTGCATTTTGAACAAAGAATTGG + Intergenic
1169698915 20:8424767-8424789 TGGCGTTTTGCACAAAGAATTGG + Intronic
1169789238 20:9392189-9392211 TGGCATCTTGAACAAAGAATCGG + Intronic
1170018733 20:11812469-11812491 TGGCGTTTTGAACAAAGAATTGG + Intergenic
1170048586 20:12114239-12114261 TGGCACTTTAAACAAAGAATTGG - Intergenic
1170709836 20:18780687-18780709 TGGCTTCTTGAACAAAGAATTGG - Intergenic
1171232273 20:23496936-23496958 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1172175890 20:32971566-32971588 TGGAATCTTGAACAAAGAATTGG - Intergenic
1172209691 20:33188131-33188153 TGGTGTCTTGAACAAAGAATTGG - Intergenic
1172264422 20:33598541-33598563 GGGCACCTTGAAAAAAGAACAGG - Intronic
1172343876 20:34181459-34181481 TGGCATCTTGAATAAAGAATTGG + Intergenic
1172470327 20:35189067-35189089 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1172678683 20:36695316-36695338 GGGCACCTTGAAAAAAGAACTGG + Intronic
1172715552 20:36960674-36960696 TGGCATCTTGCACAGAGAATTGG - Intergenic
1173288508 20:41693852-41693874 TGGTGTCTTGAACAAATAATTGG + Intergenic
1173310439 20:41892127-41892149 CGGCATCTTGGAGAAAGAGTGGG - Intergenic
1173364139 20:42369788-42369810 TGGCATCATGGACATACAATTGG - Intronic
1173485634 20:43439012-43439034 TGGCGTCTTGAACAAAGAATTGG - Intergenic
1173632460 20:44526900-44526922 TGGCATCTTGAACAAAGAATTGG - Intergenic
1173748711 20:45458752-45458774 TGACTTCTGGAACAAAGAAGTGG + Intergenic
1173960046 20:47063911-47063933 TGACATTTTGAACAAAGGATTGG - Intronic
1173988577 20:47282103-47282125 TGTCATGTTGTCCAAAGAATCGG + Exonic
1174260806 20:49293660-49293682 GGGCATCCTGAAAAAAGAACAGG + Intergenic
1174428821 20:50452704-50452726 GGCCATGTTGAACAAAAAATAGG - Intergenic
1174572089 20:51509060-51509082 TGACATCTTGAACAGAGAGGAGG - Intronic
1175057414 20:56210805-56210827 TGGTGTCTTGAACAAAGAACTGG + Intergenic
1175602608 20:60287305-60287327 TGGCATTTTGAACAAAGTATTGG - Intergenic
1176771740 21:13080718-13080740 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1176963756 21:15188872-15188894 TGGCCCATTGAACAATGAATAGG - Intergenic
1177128280 21:17223891-17223913 TTGGATCTTAAACAAAGAAAAGG + Intergenic
1177365726 21:20133232-20133254 TGGCATCTTGAACAAAGTATTGG - Intergenic
1177382240 21:20359807-20359829 TGGCATGGTGACCAAATAATTGG - Intergenic
1177491335 21:21829771-21829793 TGGCATTTTGTATAAAGATTTGG - Intergenic
1177533596 21:22396544-22396566 TGGTGTCTTGAACAAAGAATTGG - Intergenic
1177534273 21:22403502-22403524 TGGCATCTTGAACAAAGAATTGG - Intergenic
1177588880 21:23135716-23135738 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1177897148 21:26866977-26866999 GGGCATTCTGAACAAAAAATTGG - Intergenic
1178018229 21:28377141-28377163 TGGTGTCTTGAACAAAGAATTGG - Intergenic
1178026879 21:28478288-28478310 AGGTATCCTGAACAGAGAATGGG - Intergenic
1178975784 21:37220221-37220243 GGCGTTCTTGAACAAAGAATTGG - Intergenic
1179003176 21:37482960-37482982 GGGCACCTTGAAAAAAGAACAGG - Intronic
1179012384 21:37565733-37565755 TGGCGTCTTGTACAAAGAACTGG + Intergenic
1179497193 21:41779739-41779761 TGGCATTTTGAACAAAGAATTGG - Intergenic
1179950269 21:44705360-44705382 GGGCACCTTGAAAAAAGAACAGG + Intronic
1179969921 21:44830091-44830113 TGGCGTTTTGAACAATGAATTGG + Intergenic
1180133906 21:45848084-45848106 TGGCATCTCGAACAAAGGATTGG + Intronic
1180134491 21:45853380-45853402 TGGCGTTTTGAAAAAATAATTGG + Intronic
1180518867 22:16175165-16175187 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1180894597 22:19320576-19320598 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1180932700 22:19604219-19604241 TGGTGTTTTGAACAAAGAATTGG - Intergenic
1181377174 22:22468780-22468802 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1181601649 22:23955894-23955916 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1181874189 22:25927146-25927168 GGGCACCTTGAAAAAAGAACAGG + Intronic
1182331630 22:29555224-29555246 TGGAATCTGGAATACAGAATTGG - Exonic
1182386113 22:29942803-29942825 GGGCACCTTGAAAAAAGAACAGG - Intronic
1182622765 22:31626941-31626963 TGCCATCTAAAGCAAAGAATAGG + Intronic
1182894323 22:33846495-33846517 GGGCACCTTGAAAAAAGAACAGG + Intronic
1183171380 22:36190706-36190728 GGGCACCTTGAAAAAAGAACAGG - Exonic
1184022064 22:41827439-41827461 TGATGTCTTGAACAAAGAATTGG + Intergenic
1184062901 22:42095514-42095536 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1184168870 22:42746993-42747015 TGGCATCTTGAACAAAGAATTGG - Intergenic
1184359427 22:44005948-44005970 TGGCGTTTTGAACAAAGAATTGG - Intronic
1184510694 22:44931605-44931627 TGGCATCATGAACTAAGGATTGG + Intronic
1184819308 22:46897112-46897134 TGGTGCTTTGAACAAAGAATTGG + Intronic
1185107802 22:48884314-48884336 TGGCATTTTGAACAAAGAATTGG - Intergenic
949131976 3:514393-514415 TGACATCATTAACAAGGAATTGG - Intergenic
949211568 3:1509283-1509305 TGGAAGCTAAAACAAAGAATTGG + Intergenic
949280720 3:2343690-2343712 TGGCATTTTGAACAAAGAATAGG - Intronic
949483088 3:4512286-4512308 AGGCTGTTTGAACAAAGAATAGG + Intronic
949787855 3:7761489-7761511 GGGCACCTTGAAAAAAGAACAGG + Intergenic
950412056 3:12845057-12845079 TGGCGTCTTGAACAAAGAATTGG + Intronic
951188442 3:19741386-19741408 TGGTGTCTTGAACAAAGAGTTGG - Intergenic
951301965 3:21009421-21009443 GGGCACCTTGAAAAAAGAACAGG + Intergenic
951399482 3:22214400-22214422 GGGCACCTTGAAAAAAGAACAGG + Intronic
951834245 3:26963520-26963542 CGGCATTTTGAACAAAGAATTGG - Intergenic
951841352 3:27037718-27037740 TGGCATCTTGAACAAAGAATTGG + Intergenic
951857402 3:27213220-27213242 TGGCATCTTGAACAAAGAATTGG - Intronic
951995939 3:28728950-28728972 TGGCTTCTTTTAAAAAGAATAGG - Intergenic
952321343 3:32280667-32280689 TGGCACTTTGAGCAAAGAATTGG - Intronic
952662190 3:35865225-35865247 TGGCATTTTGAACAAAGAATTGG - Intergenic
952725399 3:36578828-36578850 GGGCATCTTGAAAAAAGAACAGG - Intergenic
952934001 3:38381430-38381452 GGGCACCTTGAAAAAAGAACAGG + Intronic
953319160 3:41956473-41956495 TGGCATTTTGAGCAAAGAACTGG - Intronic
953419482 3:42743218-42743240 TGGCATCTTGAGCAACACATTGG + Intronic
953519560 3:43628505-43628527 GGGCACCTTGAAAAAAGAACAGG + Intronic
953994157 3:47506666-47506688 GGGCACCTTGAAAAAAGAACAGG - Intronic
954219300 3:49143131-49143153 GGGCACCTTGAAAAAAGAACAGG - Intergenic
954281997 3:49587477-49587499 TGGCATTTTGAACAAAGAATTGG + Intronic
955090417 3:55744796-55744818 TGGAGTTTTGAACAAAGAATTGG - Intronic
955261833 3:57399012-57399034 TGACATCCAGAACAAAAAATGGG + Intronic
955400005 3:58584973-58584995 TGGCGTCATGAACAAAGAATTGG - Intronic
955514897 3:59716664-59716686 GGGCACCTTGAAAAAAGAACAGG - Intergenic
955623735 3:60894142-60894164 TGGCATCTGAAACAAAAGATGGG + Intronic
955710887 3:61778127-61778149 TGGTGTTTTGATCAAAGAATTGG + Intronic
955904805 3:63795451-63795473 TGGCATTTTGAACAAAGAATTGG - Intergenic
956131373 3:66056751-66056773 GGGCACCTTGAAAAAAGAAAAGG - Intergenic
956300537 3:67767761-67767783 TGGGACCTTGAACAAGGAGTAGG + Intergenic
957297144 3:78346643-78346665 TGGTGTCTTGAACAAAGAACTGG - Intergenic
957373413 3:79325786-79325808 GGGCACCTTGAAAAAAGAACAGG + Intronic
957430961 3:80105615-80105637 TGGTATGTTGAACAAAGAATTGG - Intergenic
957457244 3:80467365-80467387 GGGCACCTTGAAAAAAGAACAGG - Intergenic
957718805 3:83968671-83968693 TGGCGTCTTGAACAAAGATTTGG - Intergenic
957719222 3:83972112-83972134 TGGCATCTTGGACAAAGAATTGG - Intergenic
957952965 3:87148491-87148513 TGGTGTTTTGAACAAAGAATTGG - Intergenic
958625301 3:96615167-96615189 GGGCACCTTGAAAAAAGAACAGG - Intergenic
958684173 3:97371613-97371635 GGGCACCTTGAAAAAAGAACAGG + Intronic
958722112 3:97856293-97856315 GGGCACCTTGAAAAAAGAACAGG - Intronic
958845249 3:99258434-99258456 TGGCATTTTGAACAAAGAATTGG + Intergenic
958999034 3:100940079-100940101 GGGCACCTTGAAAAAAGAACAGG - Intronic
959126328 3:102294289-102294311 GGGCACCTTGAAAAAAGAACAGG + Intronic
959222281 3:103535711-103535733 TGGCATCTTGGACAAAGAACTGG - Intergenic
959465006 3:106674922-106674944 TGATGTTTTGAACAAAGAATTGG - Intergenic
959470500 3:106744300-106744322 GGGCACCTTGAAAAAAGAACAGG + Intergenic
959523043 3:107342388-107342410 TGGCATTTTGAACAAAGAATTGG - Intergenic
959596655 3:108136358-108136380 TGGCGCTTTGAACAAAGAATTGG + Intergenic
959936713 3:112037095-112037117 GGGCACCTTGAAAAAAGAACAGG + Intronic
959968646 3:112383678-112383700 TGGCATCTGGAACAAAGAATTGG + Intergenic
960172611 3:114480039-114480061 GGGCATCTTCAACAAAAATTAGG - Intronic
960308494 3:116091288-116091310 GGGCACCTTGAAAAAAGAACAGG - Intronic
960374286 3:116879131-116879153 GGGCACCTTGAAAAAAGAACAGG - Intronic
960541243 3:118864890-118864912 GGGCACCTTGAAAAAAGAACAGG + Intergenic
960889819 3:122435896-122435918 GGGCACCTTGAAAAAAGAAGAGG + Intronic
961711056 3:128828510-128828532 TGGTGTCTTGAACAAAGAATTGG + Intergenic
961862357 3:129927052-129927074 TTGCATAATGAAGAAAGAATTGG + Intergenic
961892166 3:130139396-130139418 GGGCATCCTGAAAAAAGAACAGG - Intergenic
961909298 3:130298645-130298667 GGGCACCTTGAAAAAAGAACAGG + Intergenic
961922636 3:130444188-130444210 GGGCACCTTGAAAAAAGAACAGG - Intronic
961923707 3:130453035-130453057 GGGCACCTTGAAAAAAGAACAGG - Intronic
962245548 3:133788505-133788527 GGGCATATTGAACCAAGAATTGG - Intronic
962246289 3:133796672-133796694 TGGCTTCTTGAACAAATAATTGG - Intronic
962765365 3:138557260-138557282 GGGCACCTTGAAAAAAGAACAGG - Intronic
962818520 3:139023520-139023542 AGCCATTTTGAAAAAAGAATGGG - Intronic
962838968 3:139216430-139216452 TGACATCTGGAAGAAGGAATGGG - Intronic
963176614 3:142304324-142304346 GGGCACCTTGAAAAAAGAACAGG - Intergenic
963230763 3:142906906-142906928 TGGCATTTTGAAGAAAGAATTGG + Intergenic
963349758 3:144137914-144137936 GGGCACCTTGAAAAAAGAATAGG - Intergenic
963499957 3:146113775-146113797 GGGCACCTTGAAAAAAGAACAGG + Intronic
963575727 3:147059124-147059146 TGGCATCTTGAATAAAGAATTGG - Intergenic
963659868 3:148112107-148112129 GGGCACCTTGAAAAAAGAACAGG + Intergenic
963663983 3:148159216-148159238 GGGCACCTTGAAAAAAGAACAGG + Intergenic
963770955 3:149385663-149385685 TGGCGTTTTGAACAAAGAATTGG + Intergenic
963834152 3:150039194-150039216 TGGCATCTTGAACAAAGAATTGG - Intronic
963914131 3:150842002-150842024 TGGCATTTTGAACAAAGAATTGG - Intergenic
964196195 3:154067700-154067722 GGGCACCTTGAAAAAAGAACAGG + Intergenic
964300729 3:155282437-155282459 TGGCGTCTTGAACAAAGAATTGG - Intergenic
964554841 3:157925673-157925695 TGGTGTGTTGAACAAAAAATTGG + Intergenic
964627750 3:158775762-158775784 TGGCATCTTGAACAAAGAATTGG + Intronic
964880445 3:161417531-161417553 GGGCACCTTGAAAAAAGAACAGG - Intergenic
964908111 3:161743670-161743692 GGGCACCTTGAAAAAAGAACAGG + Intergenic
965111660 3:164432405-164432427 TGGCAGCTAGAAAAAAAAATGGG + Intergenic
965242544 3:166221135-166221157 TGGTATTTTGAACAAAGAGTTGG - Intergenic
965306971 3:167078000-167078022 TGGCATCTTGAACAAAGAATTGG + Intergenic
965400769 3:168209807-168209829 GGGCACCTTGAAAAAAGAACAGG - Intergenic
965534941 3:169813794-169813816 TGGCGTCTTGAACAAAGAATTGG - Intergenic
965902179 3:173655858-173655880 TGGCAACTTGAACAAAGAATTGG + Intronic
965903545 3:173673777-173673799 TGGCATCTTGAACAAAGAATTGG + Intronic
965928960 3:174018229-174018251 GGGCACCTTGAAAAAAGAACAGG - Intronic
966124812 3:176563648-176563670 GGGCACCTTGAAAAAAGAACAGG + Intergenic
966142540 3:176772286-176772308 GGGCACCTTGAAAAAAGAACAGG + Intergenic
966151330 3:176870097-176870119 GGGCACCTTGAAAAAAGAACAGG - Intergenic
966682960 3:182662760-182662782 TGGCATCTTCAGCAACAAATTGG + Intergenic
966817290 3:183899755-183899777 GGGCACCTTGAAAAAAGAACAGG + Intergenic
966993275 3:185255305-185255327 TGGCGTTTTGAACAAAGAATTGG + Intronic
967242305 3:187452214-187452236 TGGCCTTTTAAACAAAGAATTGG + Intergenic
967268496 3:187713384-187713406 TGGCATTTTGAACAAAGAATTGG + Intronic
967292202 3:187932244-187932266 GGGCACCTTGAAGAATGAATAGG - Intergenic
967412818 3:189183770-189183792 GGGCATCTTGAAAAAAGAACAGG - Intronic
967497821 3:190161905-190161927 GGGCACCTTGAAAAAAGAACAGG + Intergenic
967567117 3:190986394-190986416 GGGCACCTTGAAAAAAGAACAGG + Intergenic
967952117 3:194849236-194849258 TGGCATCTTGAACAAAGAATTGG + Intergenic
968192936 3:196683764-196683786 GGGCACCTTGAAAAAAGAACAGG - Intronic
968212201 3:196858198-196858220 GGGCACCTTGAAAAAAGAACAGG - Intergenic
968367772 3:198200391-198200413 GGGCACCTTGAAAAAAGAACAGG - Intergenic
968386072 4:139653-139675 TGACGTCTTTAACAAAGAATTGG - Intronic
968386554 4:144254-144276 TGGCATCTTGAACAAAGAATTGG - Intronic
968396945 4:247635-247657 GGGCACCTTGAAAAAAGAACAGG - Intergenic
968420942 4:484363-484385 TGGCACCTTGAAAAAAGAACAGG + Intronic
968937577 4:3620244-3620266 TGGCATTTTGAACAAAGACTTGG + Intergenic
968949375 4:3682699-3682721 TGGTGTTTTGAACAAAGAATTGG - Intergenic
969085329 4:4652243-4652265 TGGCGTTTTGAACAAAGAATTGG - Intergenic
969655622 4:8496292-8496314 TGGTGTTTTGAACAAAGAATTGG - Intergenic
969698819 4:8754271-8754293 TGGCTTGTTGAACAAAGAATTGG + Intergenic
969916523 4:10497006-10497028 TGGCATCTTGAACAAAGAATTGG - Intronic
970175298 4:13333340-13333362 TGGTGTTTTGAACAATGAATTGG - Intergenic
970228419 4:13883581-13883603 TGGCATTTTGAACAAAGAATTGG + Intergenic
970342367 4:15120344-15120366 GGGCACCTTGAAAAAAGAACAGG + Intergenic
970422161 4:15915464-15915486 TGGTGCATTGAACAAAGAATTGG + Intergenic
970811067 4:20094602-20094624 TGGCATCTTGAACAAAGAATTGG - Intergenic
970933478 4:21540532-21540554 AGTCATCTTGAACACTGAATTGG - Intronic
971213272 4:24640259-24640281 TGGCGTCTTAAAAAAAGAATTGG + Intergenic
971319100 4:25590971-25590993 CGGCATCTCGAACAAAGAATTGG - Intergenic
971365790 4:25976157-25976179 GGGCACCTTGAAAAAAGAACAGG + Intergenic
971586366 4:28409509-28409531 AGGCACCTTGAAAAAAGAACAGG - Intergenic
971718237 4:30209313-30209335 TTCCTTCTTAAACAAAGAATGGG + Intergenic
971718742 4:30216386-30216408 GGGCACCTTGAAGAAAGAACAGG - Intergenic
971857221 4:32059125-32059147 TGGCATCTTGAACAAAGAATTGG + Intergenic
971860954 4:32104746-32104768 TGGTGTCTTGAACAAGGAACTGG - Intergenic
971899820 4:32645629-32645651 GGGCACCTTGAAAAAAGAACAGG + Intergenic
971987591 4:33846257-33846279 GGGCACCTTGAAAAAAGAACAGG - Intergenic
972038259 4:34554432-34554454 GGGCACCTTGAAAAAAGAACAGG - Intergenic
972116527 4:35642527-35642549 TGGCGTATTTAACAAATAATTGG + Intergenic
972238160 4:37158241-37158263 TGGTTTTTTGAACAAAGAATTGG - Intergenic
972458104 4:39273639-39273661 TCGCATCTGGAACATAGATTTGG - Intronic
972574780 4:40341773-40341795 TGACATTTTGAACAAAGAATTGG - Intronic
972675386 4:41255595-41255617 TGGAATCTTAGATAAAGAATGGG + Intergenic
972745735 4:41930825-41930847 TGGCATTTTGAACAAAGAATTGG - Intergenic
972746119 4:41934510-41934532 TGGCGTTTTGAACATAGAATTGG - Intergenic
972822194 4:42714602-42714624 TTACATCTTGAACAAAGAATTGG + Intergenic
972847409 4:43006259-43006281 GGGCACCTTGAAAAAAGAACAGG + Intronic
972894272 4:43599288-43599310 TGGCATTTTGAACAAAGAATTGG + Intergenic
973117898 4:46484196-46484218 TGGCATCTTGAACAAAGAATTGG + Intergenic
973335470 4:48951498-48951520 TGGCATCTCGAACAAAGAACTGG + Intergenic
973585856 4:52390396-52390418 GGGCACCTTGAAAAAAGAACAGG + Intergenic
973615427 4:52672969-52672991 GGGCACCTTGAAAAAAGAACAGG - Intergenic
973794948 4:54415801-54415823 TGGGGTTTCGAACAAAGAATTGG + Intergenic
973798168 4:54449959-54449981 GGGCACCTTGAAAAAAGAAAAGG + Intergenic
973908397 4:55553406-55553428 TTGCGTTTTGAACTAAGAATTGG + Intergenic
973943672 4:55935860-55935882 GGGCACCTTGAAAAAAGAACAGG + Intergenic
973945126 4:55947898-55947920 TGGTGTTATGAACAAAGAATTGG + Intergenic
974022604 4:56705190-56705212 TGGCATCTTGAACGAAGAATTGG + Intergenic
974190359 4:58495659-58495681 TGGCATCCTGAACAAAGAATGGG + Intergenic
974323922 4:60389531-60389553 TGGCATCTTGAACAAAGAATTGG + Intergenic
974436984 4:61869242-61869264 TGGCATGTTAAAAAAAAAATGGG - Intronic
974479571 4:62425668-62425690 TGGCATTTTGAACAAAGAATTGG + Intergenic
974479798 4:62428426-62428448 TGGAGTTTTTAACAAAGAATTGG + Intergenic
974532239 4:63123821-63123843 TGGCATTTCAAACAAAGAATTGG - Intergenic
974548656 4:63345309-63345331 GGGCACCTTGAAAAAAGAACAGG + Intergenic
974648599 4:64726132-64726154 TGCTGTCCTGAACAAAGAATTGG - Intergenic
974649506 4:64735653-64735675 TGATGTCTTCAACAAAGAATTGG - Intergenic
974986519 4:69034175-69034197 GGGCACCTTGAAAAAAGAACAGG + Intronic
975024866 4:69535433-69535455 GGGCACCTTGAAAAAAGAACAGG + Intergenic
975140659 4:70915287-70915309 TGACATCTTGAACAAAGAATTGG + Intronic
975336831 4:73187723-73187745 TGGCATCTGGAACAAAGAATTGG - Intronic
975442902 4:74433547-74433569 TTGCATTTTGAACAAAGAATTGG + Intergenic
975508101 4:75161604-75161626 GGGCATCATGAACAAAAAAGAGG - Intergenic
975512555 4:75209831-75209853 TGGCTTGTGGAACAAATAATTGG - Intergenic
975587473 4:75964971-75964993 TGAAATCTTGAAAAAAGAACAGG + Intronic
975629526 4:76386597-76386619 TGGCATCTTGAACAAAGAATTGG - Intronic
975639878 4:76489848-76489870 TGGTGTTTTGAACAAAGAATTGG + Intronic
975826961 4:78330395-78330417 GGGCACCTTGAAAAAAGAACAGG + Intronic
976023608 4:80661678-80661700 GGGCACCTTGAAAAAAGAACAGG + Intronic
976259587 4:83133337-83133359 TTGGATCCTAAACAAAGAATTGG + Intronic
976437251 4:85032417-85032439 TGGCATTTTGAATAAAGAATTGG + Intergenic
976558122 4:86473023-86473045 TGGAGTCTTGAACAAAGTATTGG - Intronic
976620099 4:87118785-87118807 TGGTGTTTTGAACAAAGAATTGG + Intronic
976638801 4:87315379-87315401 TGGCATCTTGAACAAAGAATTGG - Intronic
976693085 4:87889577-87889599 GGGCACCTTGAAAAAAGAACAGG - Intergenic
976814639 4:89133535-89133557 TGGCATTTTGAACAAAGAATTGG + Intergenic
976990855 4:91363750-91363772 TAAGATCTTGATCAAAGAATAGG - Intronic
977388825 4:96381937-96381959 GGGCACCTTGAAAAAAGAACAGG - Intergenic
977473468 4:97473171-97473193 GGGCACCTTGAAAAAAGAACAGG + Intronic
978033859 4:103971364-103971386 TGGCATTTTAAACAAAGAATAGG - Intergenic
978211937 4:106147766-106147788 GGGCACCTTGAAAAAAGAACAGG + Intronic
978396363 4:108284869-108284891 TGGCACTTTGAACACAGAATTGG + Intergenic
978455874 4:108890750-108890772 TGGAATCTAGAACAAGGAAATGG - Intronic
978588986 4:110303676-110303698 TGGTGTCTTGAACAAAGAACTGG - Intergenic
978950538 4:114553916-114553938 TGGCATCTTGAACAAGGAAGTGG + Intergenic
979016598 4:115441966-115441988 GGGCACCTTGAAAAAAGAACAGG - Intergenic
979195859 4:117919505-117919527 GGGCACCTTGAAAAAAGAACAGG + Intergenic
979247786 4:118529078-118529100 TGGAAATTTGAACAAAGCATTGG - Intergenic
979424131 4:120544619-120544641 TGGCGTTTTGACCAAAGAATTGG + Intergenic
979619918 4:122787367-122787389 TGGCATCTTGAACAAAGTATTGG + Intergenic
979678232 4:123432928-123432950 GGGCACCTTGAAAAAAGAACAGG + Intergenic
979993791 4:127407394-127407416 GGGCACCTTGAAAAAAGAACAGG + Intergenic
980113243 4:128654563-128654585 TGGCATTTTGAACAAAGAATTGG + Intergenic
980231943 4:130056907-130056929 GGGCACCTTGAAAAAAGAACAGG + Intergenic
980267837 4:130542980-130543002 TGGCGTTTTGAACAAATAATTGG + Intergenic
980278334 4:130684528-130684550 GGGCACCTTGAAAAAAGAACAGG - Intergenic
980301852 4:131006470-131006492 TGGCGTCTTCAACAAAGAATTGG + Intergenic
980302776 4:131015081-131015103 TGGCATCTTGAACAAAGAATCGG + Intergenic
980313223 4:131162532-131162554 GGGCACCTTGAAAAAAGAACAGG - Intergenic
980318462 4:131237183-131237205 TGGTGTTTTGAACAAAGAATTGG - Intergenic
980328292 4:131377045-131377067 TGGCGTCTTGAACAAAGACTTGG - Intergenic
980407424 4:132371295-132371317 TGGCATTTTGAACAAAGGATTGG - Intergenic
980577168 4:134698643-134698665 GGGCACCTTGAAAAAAGAACAGG + Intergenic
980646848 4:135653224-135653246 GGGCACCTTGAAAAAAGAACAGG - Intergenic
980936811 4:139233493-139233515 TGGCATCTTGAACAAAGAACTGG + Intergenic
980937721 4:139242122-139242144 TGGCTTCCTGAACAAAGAATTGG + Intergenic
981015753 4:139972347-139972369 GGACATTTTGAACAAAGGATTGG - Intronic
981346424 4:143682637-143682659 TTGCATTTTGAACTAAGAATTGG - Intronic
981421179 4:144551801-144551823 GGGCACCTTGAAAAAAGAACAGG - Intergenic
981592846 4:146383637-146383659 TGGAAGTTTGAACAAAGAATTGG - Intronic
981600022 4:146476974-146476996 TGGCTTATTGTACAAAGAACTGG - Intronic
981989665 4:150902746-150902768 TGGTGTCTTGAACAAAGGATTGG - Intronic
982043351 4:151417083-151417105 TGGTGCTTTGAACAAAGAATTGG + Intronic
982240706 4:153296604-153296626 TGGAAACTTGGAGAAAGAATGGG + Intronic
982778036 4:159462066-159462088 TGTCCTCTTGTACAAAGAAATGG - Intergenic
982830745 4:160056161-160056183 GGGCACCTTGAAAAAAGAACAGG - Intergenic
982903856 4:161043183-161043205 GGGCACCTTGAAAAAAGAACAGG - Intergenic
983090105 4:163493368-163493390 TGGCGTTTTGAACAAATAATTGG - Intergenic
983208117 4:164932263-164932285 TGCCTTCTTGAATGAAGAATTGG + Intergenic
983419074 4:167495320-167495342 GGGCTCCTTGAAAAAAGAATAGG + Intergenic
983564162 4:169132117-169132139 TCGCGTTTTGAACAAAGAATTGG - Intronic
983894210 4:173064139-173064161 GGGCACCTTGAAAAAAGAACAGG - Intergenic
984017789 4:174446213-174446235 TGGAGTCTTGAACAAAGAATCGG - Intergenic
984064294 4:175028813-175028835 GGGCACCTTGAAAAAAGAACAGG - Intergenic
984286899 4:177742129-177742151 TGGCATTTTGAACAAAGAATTGG + Intronic
985062838 4:186095399-186095421 TCGCGTCTTGAACAAAGAATTGG - Intergenic
985226455 4:187766199-187766221 TGGCGTCTTGAACAAAGTACTGG - Intergenic
985328103 4:188795705-188795727 TGGAATCTTCAACAATTAATTGG - Intergenic
985353523 4:189092937-189092959 TGACATTTTGAACAAAGAGTTGG - Intergenic
985428914 4:189858731-189858753 TGGTGTTTTGAACAAAGAATTGG - Intergenic
985577797 5:681762-681784 TGGCATCTTCAAAAAAGGCTTGG + Intronic
985690769 5:1310948-1310970 TGGTGTTTTGAACTAAGAATTGG + Intergenic
985767867 5:1789812-1789834 TGGTGTCTTGAACAAAGAATTGG - Intergenic
986213123 5:5692787-5692809 TGGCATCTTGAACAAAGAATTGG - Intergenic
986216167 5:5721195-5721217 TGGCATCTGGAGCAACTAATAGG - Intergenic
986238295 5:5933247-5933269 TGGCATCTTGAACAAAGAATTGG - Intergenic
986369820 5:7068716-7068738 TGGCATCTTGAACAAATAATTGG + Intergenic
986371646 5:7086319-7086341 TGGCATGCCGAACAAAGAACTGG - Intergenic
986484985 5:8227003-8227025 TGGTGTTTTGAACAAAGAGTTGG + Intergenic
986809015 5:11336232-11336254 TGGCATGTTGAACAAAGAATTGG - Intronic
987137656 5:14914737-14914759 CAGCAACTTGAACAAAGAATTGG - Intergenic
987139509 5:14930897-14930919 TGGCATCTTGAACAAAGAATTGG - Intergenic
987324326 5:16798633-16798655 TGGCATTTTAAACAAAGTAGTGG - Intronic
987571968 5:19675627-19675649 GGGCACCTTGAAAAAAGAACAGG - Intronic
987583314 5:19823136-19823158 GGGCACCTTGAAAAAAGAACAGG - Intronic
987689708 5:21251384-21251406 GGGCACCTTGAAAAAAGAACAGG + Intergenic
987703314 5:21429721-21429743 TGGCATCTTGAAAAATGTATAGG + Intergenic
987765413 5:22222119-22222141 TGCCCTATTGAACAAAGTATTGG + Intronic
987841704 5:23231032-23231054 TGACGTCATGAACAAAGAATTGG + Intergenic
987842342 5:23237526-23237548 TGGCATCTTGAACAAATAATTGG + Intergenic
987870833 5:23614629-23614651 TGGCATCCTGAATAAAGAATTGG + Intergenic
987938130 5:24496008-24496030 TGGTGTCTGGAACAATGAATGGG + Intronic
988144667 5:27290705-27290727 TGGCATCTTGAACAAAAAATTGG - Intergenic
988240255 5:28599303-28599325 GGGCACCTTGAAAAAAGAACAGG + Intergenic
988599187 5:32623778-32623800 TGGCGTCTTGAACAAAGAATTGG - Intergenic
988717698 5:33844229-33844251 GGGCACCTTGAAAAAAGAACAGG + Intronic
988720244 5:33870135-33870157 GGGCACCTTGAAAAAAGAACAGG - Intronic
988830491 5:34982259-34982281 GGGCACCTTGAAAAAAGAACAGG - Intergenic
989002500 5:36775655-36775677 TGGAGTTCTGAACAAAGAATTGG - Intergenic
989281443 5:39648794-39648816 TGGCATTAAGTACAAAGAATTGG - Intergenic
989317846 5:40103256-40103278 GGGCATCTTGAAAAAAGAACAGG + Intergenic
989318872 5:40112056-40112078 GGGCATCTTGAAAAAAGAACAGG + Intergenic
989567649 5:42916863-42916885 TGGCGTCTTGAAGAAAGAATTGG + Intergenic
989598529 5:43180676-43180698 TGGCATCTTGAACAAAGAATTGG + Intronic
989816223 5:45740885-45740907 TGCCATCTTGAACCAACAGTAGG - Intergenic
989828702 5:45889890-45889912 GGGCACCTTGAAGAAAGAACAGG - Intergenic
989830823 5:45915989-45916011 GGGCACCTTGAAAAAAGAACAGG - Intergenic
990300441 5:54444591-54444613 GGGCACCTTGAAAAAAGAACAGG + Intergenic
990302407 5:54461879-54461901 GGGCACCTTGAAAAAAGAACAGG - Intergenic
990339661 5:54809697-54809719 GGGCACCTTGAAAAAAGAACAGG - Intergenic
990346382 5:54875919-54875941 GGGCACCTTGAAAAAAGAACAGG + Intergenic
990364329 5:55054471-55054493 TGGCATTTTAAACAAAGAACTGG + Intergenic
990395633 5:55375548-55375570 GGGCACCTTGAAAAAAGAACAGG - Intronic
990688256 5:58332919-58332941 TGCTATTTTGAAGAAAGAATTGG + Intergenic
991005068 5:61820855-61820877 TGGAATTTAGAACAAAGGATGGG + Intergenic
991137206 5:63195825-63195847 GGGCACCTTGAAAAAAGAACTGG + Intergenic
991712525 5:69422198-69422220 GGGCACCTTGAAAAAAGAACAGG + Intronic
991913750 5:71586470-71586492 TGGCATTGTGAACAAAGAATTGG + Intergenic
991991653 5:72345338-72345360 GGGCACCTTGAAAAAAGAACAGG - Intronic
992171175 5:74103539-74103561 TGGCGTTTTGAACCAAGAATTGG - Intergenic
992435922 5:76756060-76756082 TGGCATCTTGAACAAAGAATTGG + Intergenic
992461589 5:76965844-76965866 TGGCGTTTTGAACAAAGAATTGG + Intronic
992955137 5:81900870-81900892 GGGCACCTTGAAAAAAGAACAGG + Intergenic
993321665 5:86477314-86477336 TGCCATCTTGAACAAAGAATTGG + Intergenic
993647451 5:90477721-90477743 TGGCGTCTTGAACAAAGAATTGG + Intronic
994521402 5:100841661-100841683 TGGTGTCTTGAACAAATAATTGG - Intronic
994734302 5:103533499-103533521 GGGCACCTTGAAAAAAGAACAGG + Intergenic
995098933 5:108274478-108274500 GGGCACCTTGAAAAAAGAACAGG - Intronic
995298128 5:110543087-110543109 TGGTGTTTTGAACAAAGAATTGG - Intronic
995318261 5:110801134-110801156 TGGTGTCTTGAACAGAGAATGGG - Intergenic
995371205 5:111420844-111420866 GGGCACCTTGAAAAAAGAACAGG - Intronic
995593998 5:113729439-113729461 GGGCACCTTGAAAAAAGAACAGG - Intergenic
995598386 5:113771427-113771449 TGGCATTTTGAACAAAGAATTGG + Intergenic
995599162 5:113777007-113777029 TGGCATTTTGAACAAAGAACTGG + Intergenic
995674162 5:114643639-114643661 GGGCACCTTGAAAAAAGAACAGG + Intergenic
995809222 5:116085933-116085955 TGGCGTCTTGAACAAAGAACTGG + Intronic
995956239 5:117779656-117779678 TTGCATATTGAGCAAAGAATAGG - Intergenic
996099799 5:119434726-119434748 TTGTGTCTTGAACAAAGCATTGG - Intergenic
996109634 5:119550076-119550098 TGGCGTTTTGAACAAAGAATTGG - Intronic
996120393 5:119665380-119665402 TGGCATCTTGAACAAATAATTGG + Intergenic
996243584 5:121232386-121232408 TGGTGTTTTGAACAAAGAATTGG + Intergenic
996273368 5:121635994-121636016 TGGCATCTTGAAAAAAGAATTGG - Intergenic
996458165 5:123708943-123708965 TGACATCATGAACAGAGATTTGG - Intergenic
996596128 5:125204636-125204658 TTGCATCTTGAACAAAGAATTGG - Intergenic
996753281 5:126910757-126910779 GGGCACCTTGAAAAAAGAACAGG + Intronic
996853246 5:127976455-127976477 TGGCATTTTGAACAAAGAATTGG + Intergenic
996893141 5:128447182-128447204 AGGCACCTTGAAAAAAGAACAGG + Intronic
997089712 5:130842891-130842913 GGGCACCTTGAAAAAAGAACTGG + Intergenic
997244863 5:132338785-132338807 GGGCACCTTGAAAAAAGAACAGG - Intronic
997384288 5:133460239-133460261 CGGTGTCTTGAACAAAGAATTGG - Intronic
997765508 5:136499496-136499518 GGGCACCTTGAAAAAAGAACAGG - Intergenic
997920738 5:137976892-137976914 GGGCACCTTGAAAAAAGAACAGG + Intronic
998259820 5:140621581-140621603 GGGCACCTTGAAAAAAGAACAGG + Intergenic
998472812 5:142396510-142396532 TGGCATTTTGAACAAAGAATTGG + Intergenic
998585218 5:143420132-143420154 GGGCACCTTGAAAAAAGAACAGG - Intronic
998954497 5:147425036-147425058 AGACATCTAGAACAATGAATTGG - Intronic
998978498 5:147674386-147674408 TGTCTTCTTGAATGAAGAATAGG + Intronic
999093270 5:148956032-148956054 GGGCACCTTGAAAAAAGAACAGG - Intronic
999362526 5:150997992-150998014 TGGCATTTTGAACAAAGAATTGG + Intergenic
999397929 5:151242283-151242305 TGGCATTTTGAACAAAGAATCGG + Intronic
999526745 5:152414610-152414632 TGGCATCCTGAACAAAGAATTGG - Intronic
999695341 5:154183931-154183953 TGGTGTTTTGAACAAAGAATTGG - Intronic
999853194 5:155564998-155565020 TGGAATTTTGAACAAAGAACTGG - Intergenic
1000004406 5:157169885-157169907 GGGCACCTTGAAAAAAGAACAGG + Intronic
1000698498 5:164419069-164419091 TGACATCTTGAACAAAGAATTGG + Intergenic
1000959577 5:167584136-167584158 TGGCGTTTTAAACAAATAATTGG + Intronic
1001010320 5:168091806-168091828 TGGCTTCTTGAAGAAAGACCTGG + Intronic
1001189738 5:169618605-169618627 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1001522068 5:172401950-172401972 GGGCACCTTGAAAAAAGAACAGG + Intronic
1001873400 5:175178379-175178401 TGCCATCTTACAGAAAGAATGGG + Intergenic
1002015407 5:176317845-176317867 TGGCATCTTGAACAAAGAACTGG + Intronic
1002032343 5:176439656-176439678 TGGCATCTTGAACAAAGAATTGG + Intergenic
1003068784 6:2927830-2927852 GGGCATCCTGAAAAAAGAACAGG + Intergenic
1003079475 6:3009362-3009384 GGGCACCTTGAAAAAAGAACAGG - Intronic
1003162679 6:3649865-3649887 TGGCATCTTGAACAAAGAATAGG - Intergenic
1003176280 6:3753927-3753949 TGGCATCTTGAACAAAGAATTGG - Intergenic
1003440782 6:6139621-6139643 TTGAATCTTGAAAAAATAATAGG - Intergenic
1003592463 6:7447412-7447434 TGGCATCTTGAACAAAGAATTGG + Intergenic
1003931457 6:10928047-10928069 GGGCACCTTGAAAAAAGAACAGG - Intronic
1003982701 6:11404406-11404428 TGGCGTTTTGAACAAAGAATTGG - Intergenic
1004010447 6:11680980-11681002 TGGCATATGTAACAAAGATTTGG - Intergenic
1004164577 6:13244726-13244748 GGGCACCTTGAAAAAAGAACAGG - Intronic
1004416793 6:15432059-15432081 TGGCGTTTTGAACAAAGAATTGG + Intronic
1004471345 6:15932116-15932138 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1004706196 6:18126031-18126053 TGGCTTTTTGAACAAAGAATTGG + Intergenic
1004778215 6:18873019-18873041 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1004965637 6:20847795-20847817 TTGCGTTTTAAACAAAGAATTGG + Intronic
1005132337 6:22523839-22523861 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1005501589 6:26433634-26433656 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1005516951 6:26564171-26564193 TGGCGTCTTGAACAAAGAACTGG - Intergenic
1005639574 6:27783259-27783281 TGGCGTCTTAAACGAAGAATTGG - Intergenic
1005693352 6:28328564-28328586 GGGCACCTTGAAAAAAGAACAGG - Intronic
1006218403 6:32466182-32466204 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1006418104 6:33916992-33917014 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1006427092 6:33972323-33972345 TGGCGTTTTGAACAAAGAAATGG + Intergenic
1006431247 6:33998117-33998139 TGGCATTTTGAACAAATAATTGG + Intergenic
1007198938 6:40088852-40088874 TGGCGCATTGAACAAAGAATTGG - Intergenic
1007532633 6:42556316-42556338 TGGTGCTTTGAACAAAGAATTGG - Intergenic
1007579852 6:42951265-42951287 TGGCATCTTGAACGAACAATTGG + Intergenic
1007580932 6:42959668-42959690 TGGCATCTTGAACAAACAATTGG + Intergenic
1007602792 6:43093719-43093741 TTGTGTTTTGAACAAAGAATTGG + Intronic
1007691556 6:43704945-43704967 TGGCATATTTACCAAAGAAAGGG - Intergenic
1008100448 6:47385054-47385076 GGGCACCTTGAACAGAGAACAGG + Intergenic
1008170690 6:48202095-48202117 GGGCAACTTGAAAAAAGAACAGG + Intergenic
1008220316 6:48846129-48846151 CAGCATTTTGAACAAATAATTGG + Intergenic
1008230258 6:48978556-48978578 TGCCATCTTGGAAAAAAAATGGG - Intergenic
1008251272 6:49242835-49242857 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1008252669 6:49259141-49259163 TGGTGTCATGAACAAAGAATTGG - Intergenic
1008754623 6:54779263-54779285 TGGTATATTTAACACAGAATAGG + Intergenic
1008909954 6:56721237-56721259 GGGCATGTTGAAAAAAGAACAGG - Intronic
1009035971 6:58117467-58117489 TGGCTTTTTGAACAAAGAATTGG + Intergenic
1009324212 6:62329906-62329928 TGGAAACATGGACAAAGAATGGG + Intergenic
1009544118 6:65003042-65003064 GGGCACCTTGAAAAAAGAACAGG + Intronic
1009657013 6:66560435-66560457 TGGCATCTTGAGCAAAGAATTGG - Intergenic
1010103025 6:72132034-72132056 TGGCACCTTGAAAAAAGAACAGG - Intronic
1010217658 6:73419100-73419122 TGGTGTCTTGAACAAAGACTTGG - Intronic
1010305102 6:74310539-74310561 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1010405885 6:75505365-75505387 TGGTATTTTGAACAAAGAATTGG + Intergenic
1010489831 6:76461820-76461842 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1010795615 6:80113673-80113695 TGGCATTTTGAACAAAGAATTGG + Intronic
1011606367 6:89110212-89110234 TGGCATTTTTAACAAAGAATTGG + Intronic
1011878487 6:91992559-91992581 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1011908857 6:92409783-92409805 TGGCATTTTGAACAAAGAACTGG - Intergenic
1011959771 6:93073263-93073285 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1012056838 6:94423568-94423590 CGGCATCATGAACATACAATGGG - Intergenic
1012143379 6:95651177-95651199 AGGCACCTTGAAAAAAGAACAGG + Intergenic
1012380792 6:98616777-98616799 GGGTACCTTGAAAAAAGAATAGG - Intergenic
1012732621 6:102901268-102901290 TGGAATCTTGAACAAAGAATTGG - Intergenic
1012749063 6:103133948-103133970 TAGCATGTCGAACAAAGAACTGG - Intergenic
1012851185 6:104447644-104447666 TGGTGTTTTGAACAAAGAATTGG + Intergenic
1012884196 6:104825829-104825851 TGGCATTTTGAACAAAGAATTGG - Intronic
1012960385 6:105615788-105615810 GGGCACCTTGAAAAAAGAATGGG - Intergenic
1013066834 6:106692406-106692428 TTGAATCTAGGACAAAGAATGGG - Intergenic
1013104222 6:107012887-107012909 TGGTGTCTTGAACAAAGAATTGG + Intergenic
1013342229 6:109226011-109226033 TGGCATCTTGAGCACCGATTAGG + Intergenic
1013346782 6:109268465-109268487 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1013453939 6:110312790-110312812 TGGCATCTTTAACAAAGAATTGG + Intronic
1013534659 6:111052824-111052846 TGGCATTCTGAACAAAGAATTGG + Intergenic
1013807123 6:114008422-114008444 TGGCATCTTGAACAAAGAATTGG + Intronic
1013807438 6:114011197-114011219 TGGCATCTTGAACAAAGAATTGG + Intronic
1013923641 6:115441069-115441091 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1014119933 6:117712951-117712973 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1014199429 6:118591787-118591809 TGGTGCTTTGAACAAAGAATTGG - Intronic
1014290628 6:119553878-119553900 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1014319287 6:119906910-119906932 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1014352104 6:120358480-120358502 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1014466831 6:121766069-121766091 GGACATCTTGAAGGAAGAATGGG + Intergenic
1014547839 6:122753613-122753635 TGGCATTTTGAACAAAGAATTGG + Intergenic
1014669901 6:124289428-124289450 TGGCATCCTGGCCAAAGCATGGG + Intronic
1014728386 6:125001681-125001703 TGCAATTTTGAACAAAGTATAGG + Intronic
1014770179 6:125451202-125451224 GGGCAACTTGAAGAAAAAATAGG + Intergenic
1015014702 6:128398028-128398050 TGGCGTCTTGAACAAAGAATTGG + Intronic
1015161609 6:130158646-130158668 TGGCGTTTTGAACAAAGAATTGG + Intronic
1015206481 6:130645186-130645208 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1015545297 6:134355689-134355711 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1015547763 6:134378931-134378953 TGACATTTTGAACAAATAATTGG + Intergenic
1015630494 6:135227538-135227560 TGGTGTCTTGGACAAAGAATTGG - Intergenic
1016010416 6:139133622-139133644 TGGCATTTTGAACAAACAATTGG - Intergenic
1016193022 6:141294155-141294177 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1016225322 6:141728275-141728297 TGGTGTCTTGAACAAAGAATTGG + Intergenic
1016327016 6:142914282-142914304 TGGCATCTTTCAAAAAAAATTGG + Intronic
1016435163 6:144029470-144029492 TAGAATAATGAACAAAGAATAGG + Intronic
1016459123 6:144263484-144263506 TGGCACCTTGCACAAAGAATTGG - Intergenic
1016559736 6:145382360-145382382 TGGGAGGTTGAAGAAAGAATAGG + Intergenic
1016586849 6:145697804-145697826 GGGCACCTTGAAAAAAGAACAGG - Intronic
1016632039 6:146244068-146244090 GGGCACCTTGAAAAAAGAACAGG - Intronic
1016711574 6:147179075-147179097 TGGCATCTTGAAAAAACTACAGG + Intergenic
1017032950 6:150240320-150240342 TCGCGTTTTGAACAAAGAATTGG + Intronic
1017378283 6:153797062-153797084 TGGTGTCTTGAACAAAGAATTGG + Intergenic
1017392579 6:153957754-153957776 TGGCATTTTGAACAAATAATTGG - Intergenic
1017443135 6:154483090-154483112 TGGCATCTTGGACGAAGGACAGG + Intronic
1018310123 6:162499995-162500017 TGCCATCTAGAACAAGGACTTGG + Intronic
1018327032 6:162681939-162681961 TGGCATTTTGAGCAAAGAATTGG - Intronic
1018514871 6:164568574-164568596 TGGCATCTTGAACAAAGAACTGG + Intergenic
1018985139 6:168630570-168630592 GGGCACCTTGAAAAAAGAAAAGG + Intronic
1019002883 6:168770255-168770277 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1019545376 7:1571893-1571915 TGGCATCTTGAACAAAGAATTGG - Intergenic
1020048512 7:5062928-5062950 GGGCACCTTGAAAAAAGAACAGG - Intronic
1020145637 7:5640222-5640244 TGACATCATAAACAAAGATTAGG - Intronic
1020387797 7:7626710-7626732 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1020602377 7:10292291-10292313 TGGCATTTTGAACAAAGAATTGG + Intergenic
1020660227 7:10973445-10973467 TGGCGTTTTTAACAAAGAATTGG - Intergenic
1020834833 7:13136265-13136287 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1020908970 7:14104442-14104464 TGGCATTTTGAACAAAGAATTGG + Intergenic
1021028293 7:15696916-15696938 TGGCATTTTGAACAAAGAGTTGG - Intergenic
1021226874 7:18038032-18038054 TGATGTTTTGAACAAAGAATTGG - Intergenic
1021500476 7:21327908-21327930 TGGTGTTTTGAACAAAGAATTGG + Intergenic
1021651383 7:22836929-22836951 TGGTGTTTTGAACAAAGAATTGG - Intergenic
1022160760 7:27708767-27708789 TGGTGTTTTAAACAAAGAATTGG - Intergenic
1022216201 7:28264231-28264253 TGGCATCTTGAACAAAGAATTGG - Intergenic
1022457572 7:30572445-30572467 TGGTGTTTTGAACAAAGAATTGG + Intergenic
1022458357 7:30579296-30579318 TGGCATTTTGAACAAGGAACTGG + Intergenic
1022484618 7:30768884-30768906 TGCCTTCTTGAAGAGAGAATGGG - Intronic
1022765999 7:33412678-33412700 TGTCATCTTGGAAGAAGAATAGG + Intronic
1022862788 7:34385293-34385315 TGGCATTTTGAACAAAGAATTGG + Intergenic
1023091729 7:36624208-36624230 TGGCATCTTGAACAAAGAATTGG - Intronic
1023230176 7:38019631-38019653 TGGCTTTTTGAAGAAAGAATTGG - Intronic
1023635166 7:42202603-42202625 TGCCATCTTGCACAAATAAATGG + Intronic
1023668815 7:42554879-42554901 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1023742441 7:43292858-43292880 TGGCATTTTGAACAAAGAATTGG + Intronic
1023817279 7:43960841-43960863 TGGTGTCATGAACAAAGAATTGG + Intergenic
1024010548 7:45262670-45262692 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1024175994 7:46841647-46841669 TGGCATTTTGAACAAATAATTGG + Intergenic
1024191872 7:47020370-47020392 TGGCATCTCGAACAAAGAATTGG + Intergenic
1024213042 7:47223390-47223412 GGGCACCTTGAAGAAAGAACAGG + Intergenic
1024328611 7:48133998-48134020 TGACATCTTGAACAAAGAATTGG + Intergenic
1024408859 7:49015293-49015315 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1024497463 7:50064736-50064758 GGGCACCTTGAAAAAAGAACAGG - Intronic
1024499969 7:50094214-50094236 TAGCATCTTCAACAAAGACTAGG - Intronic
1024551980 7:50570192-50570214 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1024553465 7:50583219-50583241 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1024586381 7:50845471-50845493 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1024724989 7:52183823-52183845 TGGCATCTTTATCAAAGAACAGG + Intergenic
1024752368 7:52482713-52482735 TGGTATTTTGAACAAAGAACTGG + Intergenic
1024756719 7:52541808-52541830 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1024892001 7:54213624-54213646 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1025116713 7:56264493-56264515 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1025155282 7:56599625-56599647 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1025600192 7:62986970-62986992 TGGCATATTGAAAAAAGAAAAGG - Intergenic
1025619802 7:63158322-63158344 TGGCATATAGAACATAGAGTAGG - Intergenic
1025749532 7:64281297-64281319 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1025870086 7:65423232-65423254 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1026184706 7:68073517-68073539 TGGCATCTTGAACAAAGAATTGG + Intergenic
1026211917 7:68313373-68313395 TGACCTCTTGAACAAGGAATTGG + Intergenic
1026253221 7:68688985-68689007 TGGCGCTTTGAACAAAGAACTGG + Intergenic
1026353221 7:69535476-69535498 TGGGTTCCTGAACATAGAATAGG + Intergenic
1026353831 7:69540257-69540279 TGGTGTTTTGAACAAATAATTGG + Intergenic
1026495717 7:70900590-70900612 CAGCATCTTGAACAACTAATGGG - Intergenic
1026508697 7:71009286-71009308 TGGCATTTTGAACAAAGAACTGG + Intergenic
1026514208 7:71053477-71053499 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1026621033 7:71950130-71950152 TGGCATCTCGAACAAAGAATTGG - Intronic
1026730647 7:72908854-72908876 GGGCACCTTGAAAAAAGAACAGG - Intronic
1027628756 7:80576404-80576426 GGGCACCTTGAAAAAAGAATAGG + Intronic
1027643428 7:80766643-80766665 TGGCGTCTTGAGGAAAGAATTGG - Intronic
1027696061 7:81411908-81411930 TGGTGTCTTGAACAAAGAATTGG + Intergenic
1027707795 7:81555738-81555760 TGGCCTCTTGAAAAAAGCATTGG - Intergenic
1027749530 7:82124748-82124770 TGGCATTTTGAAGAAAGAACTGG - Intronic
1027775852 7:82463383-82463405 TGGCATTTTGAACAAGGAATTGG + Intergenic
1027793279 7:82659174-82659196 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1027976101 7:85158146-85158168 GGGCACCTTGAAAAAAGAACAGG + Intronic
1028435162 7:90794655-90794677 GGGCACCTTGAAAAAAGAACAGG - Intronic
1028539421 7:91925701-91925723 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1028960246 7:96740491-96740513 TGGCATATTGAAAACAGAAGGGG - Intergenic
1028999761 7:97140834-97140856 GGGCACCTTGAAAAAAGAACAGG + Intronic
1029338880 7:99926837-99926859 TGGCGTTTTGAACAAGGAATTGG + Intronic
1029368651 7:100133194-100133216 TGGTGTCCCGAACAAAGAATTGG + Intergenic
1029370150 7:100144888-100144910 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1029676388 7:102072085-102072107 TGGCGTTTTGAGCAATGAATTGG + Intronic
1030071012 7:105697509-105697531 GGGCACCTTGAAAAAAGAACAGG - Intronic
1030143843 7:106332744-106332766 TGGCATCCTGAACAAAGAACTGG - Intergenic
1030144925 7:106343240-106343262 TAGTGTCTTGAACAAAGAATTGG - Intergenic
1030431053 7:109449610-109449632 TGGCATTTTGAACAAAGAATTGG + Intergenic
1030601381 7:111596993-111597015 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1030973441 7:116090474-116090496 TGGCGTCTCGAATGAAGAATTGG - Intronic
1031051724 7:116952082-116952104 TGGCGTTTTGAACAAAGAATTGG - Intergenic
1031127375 7:117790395-117790417 GGGACTCTTGAACAAAGAAGAGG - Intronic
1031426956 7:121616852-121616874 AGGCACCTTGAAAAAAGAACAGG + Intergenic
1031636116 7:124103231-124103253 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1031668708 7:124517575-124517597 TGGCATCTTGAACAAAGAATTGG + Intergenic
1031749257 7:125550509-125550531 TGGCATTTTGAACAAAGAATTGG + Intergenic
1031867870 7:127059168-127059190 TTGTATCTTGAAAAATGAATAGG + Intronic
1031930515 7:127680654-127680676 GGGCACCTTGAAAAAAGAACAGG - Intronic
1032048512 7:128630838-128630860 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1032252647 7:130271268-130271290 TGGCGTCTTGAACAAATAATTGG + Intronic
1032311816 7:130794529-130794551 TGGCGTCTTGAACAAAGAATTGG + Intergenic
1032457571 7:132085205-132085227 TGGTGTTTTGAACAAAGAATTGG - Intergenic
1032673518 7:134107251-134107273 TGGCATCTTGAACAAAGAATTGG + Intergenic
1032700938 7:134378533-134378555 TGGCATGTTGAACAAAGAATTGG + Intergenic
1032870621 7:135980637-135980659 TGGCACTGTGAACAAAGAATTGG + Intergenic
1033023184 7:137747675-137747697 TGGTGTCTTGAACAAATAATTGG - Intronic
1033072186 7:138214272-138214294 TGGCATTTTGAACAAAGAATTGG + Intergenic
1033096318 7:138434467-138434489 TGGTGTCTTGAACAAAGAATTGG - Intergenic
1033141519 7:138831205-138831227 TGGCGTCTTGAACAAAGAGTTGG - Intronic
1033721186 7:144061025-144061047 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1033795174 7:144837161-144837183 TGGCGTCTTGAACAAAGAATTGG + Intergenic
1033849842 7:145481975-145481997 TGGCATCTTGAACAAATAATTGG + Intergenic
1033850533 7:145489011-145489033 TGGCATCTTAAACACAGAATTGG + Intergenic
1033859405 7:145606654-145606676 GGGCACCTTGAATAAAGAACAGG + Intergenic
1033874514 7:145798247-145798269 AGGCATCTTGAACAAAGAAATGG - Intergenic
1033904996 7:146191825-146191847 GGGCACCTTGAAAAAAGAACAGG - Intronic
1033983755 7:147197422-147197444 TGGCGTTTTGAACAAAGAGCTGG - Intronic
1034365395 7:150541981-150542003 TAGCATCTTTACCAAAGATTTGG - Intergenic
1034569106 7:151940942-151940964 TGGCATTTTGAACAAAGAATTGG + Intergenic
1034583888 7:152071481-152071503 GGGCACCTTGAAAAAAGAACAGG - Intronic
1034653580 7:152711875-152711897 TGGCGTTTTGAACAAAGAATTGG - Intergenic
1034684012 7:152953964-152953986 TGGCATCTTGAACAAAGAACTGG + Intergenic
1034778794 7:153858139-153858161 TGTCATTTTGAAGAAAGAAGGGG - Intergenic
1034929599 7:155151281-155151303 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1035043166 7:155945675-155945697 TGGCGTTTTGAACAAAGAATTGG - Intergenic
1035123639 7:156591218-156591240 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1035572893 8:685350-685372 GGGCATCTTGACAAAAGAACAGG - Intronic
1036158317 8:6363109-6363131 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1036159219 8:6370964-6370986 TGGCGTTTAGAACAAAGAATTGG + Intergenic
1036287888 8:7460693-7460715 TGGTGTCCTGAACAAAGAACTGG - Intronic
1036333588 8:7850835-7850857 TGGTGTCCTGAACAAAGAACTGG + Intronic
1036495992 8:9270366-9270388 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1036732696 8:11280365-11280387 TGGCATTTTGAACAAAGAATTGG + Intergenic
1036877235 8:12483558-12483580 GGGCATCCTGAAAAAAGAACAGG - Intergenic
1037044225 8:14277068-14277090 TGGCATCTTGAACAAAGAATTGG - Intronic
1037137130 8:15476599-15476621 TGGTGTTTTGAACAAAGAATTGG + Intronic
1037652893 8:20855845-20855867 TGGCATTTTGAACAAAGAATTGG + Intergenic
1037682766 8:21111262-21111284 TGGCATCTTGAACAAAGAACTGG - Intergenic
1037941474 8:22954822-22954844 GGGCATCTTGACGAAAGAAAAGG - Intronic
1038142642 8:24863565-24863587 TGGGGTTTTGAACAAAGAATCGG + Intergenic
1038382887 8:27113388-27113410 TGGTGTCTTGAGCAAAGAATTGG - Intergenic
1038404981 8:27314770-27314792 TGGCATCTTGAACAAAGAATTGG - Intronic
1038786608 8:30622885-30622907 GGGCACCTTGAAAAAAGAACAGG - Intronic
1038837203 8:31139495-31139517 TGGCTTCTTGATCACAGAAGAGG - Intronic
1038843793 8:31210404-31210426 TGGCATTTTGAACAAAGAATTGG - Intergenic
1038941032 8:32306143-32306165 GGCCATCTTTAACAAAGAATTGG - Intronic
1038945603 8:32356263-32356285 TTGTATTTTGAACCAAGAATTGG - Intronic
1038991860 8:32877104-32877126 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1039383697 8:37111096-37111118 TGGCATTTTAAACAAAGAATTGG + Intergenic
1040025603 8:42779033-42779055 GGGCACCTTGAAAAAAGAACAGG - Intronic
1040393136 8:46966939-46966961 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1040538885 8:48333660-48333682 GGGCATCTTGAAAAAAGAACAGG - Intergenic
1040555334 8:48473082-48473104 TGGCATTTTGAACAAAGAATTGG - Intergenic
1040634995 8:49262765-49262787 TGGCATCTTGAACAAAGAACTGG - Intergenic
1040679100 8:49787473-49787495 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1040682726 8:49832984-49833006 TGGTATTTTTAACAAAGAATTGG - Intergenic
1040683165 8:49838033-49838055 TGGAATGTTGAACAAAGAATTGG - Intergenic
1040840056 8:51775793-51775815 GGGCACCTTGAAAAAAGAACAGG + Intronic
1041164073 8:55073795-55073817 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1041559735 8:59202209-59202231 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1041607462 8:59799562-59799584 TAGTGTCTTGAACAAAGAATTGG - Intergenic
1041624489 8:60009857-60009879 TTGGATCTTGAACAATGACTAGG + Intergenic
1041824213 8:62073380-62073402 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1041828103 8:62121385-62121407 TGACGTCTTGAACAAAGAATGGG + Intergenic
1042413463 8:68491893-68491915 TGGCATTTTGAAGGATGAATTGG - Intronic
1042529188 8:69797406-69797428 GGGCACCTTGAAAAAAGAAAAGG + Intronic
1042703078 8:71637827-71637849 TGTTGTCTTGAAAAAAGAATGGG + Intergenic
1042709291 8:71697295-71697317 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1042912181 8:73839100-73839122 TGGCATTTTGAAGAAAGAATTGG - Intronic
1042999303 8:74737477-74737499 TGGCGTTTTGAACTAAGAATTGG - Intronic
1043324382 8:79032934-79032956 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1043327415 8:79070014-79070036 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1043423302 8:80122752-80122774 TGGTGTCCTGAACAAAGAATTGG - Intronic
1043458173 8:80432577-80432599 TGGCATCTTGAACAAAGAATTGG + Intergenic
1043575056 8:81647073-81647095 TGGCATCTTGAACAAAGAATTGG - Intergenic
1043591987 8:81843294-81843316 TGGTTTTTTTAACAAAGAATTGG + Intergenic
1043592120 8:81844305-81844327 TGGTGTTTTGAACGAAGAATTGG - Intergenic
1043593090 8:81852476-81852498 TGATGTTTTGAACAAAGAATTGG - Intergenic
1043593370 8:81855674-81855696 TGACACTTTGAACAAAGAATTGG + Intergenic
1043675662 8:82949451-82949473 TGGCATTTTGAACAAAGAATTGG - Intergenic
1043684815 8:83071947-83071969 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1044004302 8:86923057-86923079 TGGCGTTTTTAACAAAGAATTGG + Intronic
1044064060 8:87676999-87677021 GGGCATCTTGAAAAAAGAACAGG - Intergenic
1044066815 8:87708349-87708371 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1044170310 8:89043331-89043353 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1044310616 8:90687887-90687909 TGGCGTCTTGAACAAAGAATTGG - Intronic
1044413493 8:91910441-91910463 TGCCATTTTGAACAAAGAATTGG + Intergenic
1044876525 8:96673141-96673163 TGGCAGTTTGAACAAAGAATTGG + Intronic
1045288467 8:100811851-100811873 TGGTGTCTTGAACAAAGATTTGG + Intergenic
1045390355 8:101709007-101709029 TGGCATCTTAAACAAAGAATTGG + Intronic
1045429133 8:102096870-102096892 TGGCATTTTGAACAAATAATTGG - Intronic
1045538358 8:103057023-103057045 TGGTGTTTTGAACAAAAAATTGG + Intronic
1045545297 8:103123023-103123045 TGGGGTCTTGAACAAAGAACTGG - Intergenic
1045549666 8:103160136-103160158 TGGCATCTTGAACACATAATTGG + Intronic
1045798685 8:106077140-106077162 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1046076703 8:109320502-109320524 GGGCACCTTGAAAAAAGAACAGG - Intronic
1046153407 8:110257146-110257168 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1046304118 8:112339561-112339583 TGGCTTTTTGAACAAAGAATTGG - Intronic
1046383623 8:113480931-113480953 TGGCAATTTGAACAAAAAAATGG + Intergenic
1046412201 8:113860091-113860113 TGGTGTTTCGAACAAAGAATTGG - Intergenic
1046486642 8:114896059-114896081 TGGCATCTTGAACAAAGAACTGG - Intergenic
1046487285 8:114903016-114903038 TGGCATCTTGAACAAAGAATTGG - Intergenic
1046868912 8:119182218-119182240 GGGCACCTTGAAAAAAGAACAGG - Intronic
1047073939 8:121378691-121378713 TGGCGTCTTGAACAAAGAACTGG - Intergenic
1047138826 8:122112092-122112114 TGTCCTGTTGAACAAAGAAGAGG - Intergenic
1047390729 8:124448871-124448893 TGACATCTTGAACAAAGAATTGG + Intergenic
1047447569 8:124933287-124933309 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1047682895 8:127273046-127273068 TAGCACCTTGAACAAAGAATTGG - Intergenic
1047852010 8:128867119-128867141 AGGCATTTTGAAAAGAGAATTGG + Intergenic
1048002874 8:130394104-130394126 GGGCACCTTGAAAAAAGAACAGG + Intronic
1048369690 8:133766675-133766697 TGGCATCTTGGACAAAGAATAGG - Intergenic
1048500284 8:134969049-134969071 TGGCATCTCAAACAAAGAATTGG + Intergenic
1048888166 8:138925204-138925226 TGCCGTCTTGAACAAAGAATTGG - Intergenic
1048915411 8:139178128-139178150 TGGCATTTTGAACAAAGAATTGG - Intergenic
1049500885 8:142964801-142964823 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1049625904 8:143620676-143620698 TGCCATCTTGAACCAGGAAGTGG - Intergenic
1049839219 8:144760101-144760123 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1050132493 9:2427194-2427216 TGGCAGTTTGCACTAAGAATCGG + Intergenic
1050139404 9:2501954-2501976 GGGCATCTTGAATGAAGAATTGG + Intergenic
1050314391 9:4386527-4386549 TGGCGTGTTGAACAAAGAATTGG + Intergenic
1050401355 9:5259232-5259254 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1050606675 9:7309038-7309060 GGGCATCTTGTAAAAAGAACAGG + Intergenic
1050791650 9:9478777-9478799 CAGCATCTTTAACAAAGAAGAGG - Intronic
1051231688 9:14961869-14961891 TAGTGTTTTGAACAAAGAATTGG - Intergenic
1051833757 9:21311188-21311210 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1052009534 9:23389422-23389444 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1052083848 9:24239573-24239595 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1052354843 9:27493828-27493850 GGGCACCTTGAAAAAAGAACAGG + Intronic
1052371913 9:27675183-27675205 TGGCGTTTTGAACAAAGAACCGG + Intergenic
1052487965 9:29127279-29127301 TGGTATTTTGAACAAAGAATTGG - Intergenic
1052488521 9:29132692-29132714 TGGCATTTTCAACAGAGAATTGG - Intergenic
1052602113 9:30647051-30647073 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1053087625 9:35239894-35239916 GGGCACCTTGAAAAAAGAACAGG - Intronic
1053114278 9:35488425-35488447 TGGCGTTTTGAACAAAGAATTGG + Intergenic
1054453579 9:65417448-65417470 TGGCATTTTGAACAAAGACTTGG - Intergenic
1054977975 9:71170820-71170842 GGGCACCTTGAAAAAAGAACAGG + Intronic
1055343865 9:75313586-75313608 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1055668550 9:78576415-78576437 TGGCATTTTGAACAAAGAATTGG - Intergenic
1055690139 9:78821437-78821459 TGGCATTTTGAACAAAGAATTGG + Intergenic
1055725992 9:79229374-79229396 TGGTGTTTTGAACAAAGAATTGG - Intergenic
1055784803 9:79861562-79861584 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1055908087 9:81316674-81316696 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1056082812 9:83114432-83114454 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1056176464 9:84041472-84041494 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1056394171 9:86166456-86166478 TGGCATCTTGAACAAAGAATTGG - Intergenic
1056470375 9:86899849-86899871 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1057538847 9:95945354-95945376 GGGCACCTTGAAAAAAGAACAGG - Intronic
1057715734 9:97493927-97493949 GGGCACCTTGAAAAAAGAACAGG - Intronic
1058253308 9:102729397-102729419 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1058288835 9:103211934-103211956 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1058760141 9:108122661-108122683 TTGCATTTTGAGCAAAGAATTGG - Intergenic
1058922584 9:109631569-109631591 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1058971571 9:110088035-110088057 TGGCATCTTGAACAAAGAATTGG + Intronic
1058984503 9:110198490-110198512 TGGCATTTTGAACAAAGACTTGG + Intronic
1059022253 9:110589608-110589630 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1059281810 9:113140885-113140907 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1059689706 9:116673264-116673286 TGGTGGCTTGAACAAAGAATTGG - Intronic
1059784950 9:117571549-117571571 TGGCATCTTGAACAGTGAATTGG - Intergenic
1060176742 9:121502877-121502899 TGGCATTCTGAGCAAAGAATTGG - Intergenic
1060367511 9:123033507-123033529 TGGCATCTTTAGCAACTAATTGG - Intronic
1060760148 9:126240017-126240039 TGGCATCTTTAAGAAATAGTTGG + Intergenic
1060781699 9:126417862-126417884 TGGGATCTTGAAGTATGAATAGG + Intronic
1061104524 9:128519227-128519249 GGGCACCTTGAAAAAAGAACAGG + Intronic
1062468849 9:136693389-136693411 TGGCATCATGAACAAAGAATTGG - Intergenic
1062484158 9:136766082-136766104 TGGCATTTTGAACAAAGAATTGG - Intronic
1062706485 9:137946918-137946940 TGGCATTTTGAACAAAGAATTGG + Intronic
1062752113 9:138263096-138263118 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1185790886 X:2928057-2928079 TGGCGTTTTGAACAAAGAATTGG - Intronic
1185862888 X:3595505-3595527 TGGTATCTAGAACAGAGAAAAGG + Intergenic
1186150018 X:6664830-6664852 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1186166064 X:6827256-6827278 TGGTGTCTTGAACAAAGAATTGG + Intergenic
1186182175 X:6984026-6984048 TGACGTCTTGAATAAAAAATTGG - Intergenic
1186322908 X:8449812-8449834 TGGAATTTAAAACAAAGAATTGG + Intergenic
1186329111 X:8513572-8513594 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1186803649 X:13117970-13117992 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1186818252 X:13259249-13259271 TGGTCTTTTGAACAAAGAATTGG - Intergenic
1186831590 X:13395827-13395849 TGGCGTTTTGAACAAAGAATTGG + Intergenic
1186972970 X:14869465-14869487 TGGCAACTGGAACAGAGAGTTGG - Intronic
1187122422 X:16422442-16422464 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1187161814 X:16772408-16772430 TGGCGTTTTGAACAAAGAATTGG + Intergenic
1187335384 X:18377023-18377045 TGGCGTTTTGAACAAAGAATTGG - Intergenic
1187379949 X:18792711-18792733 TGGCGTCTTGAACAATGAATTGG + Intronic
1187413024 X:19067306-19067328 TGGCATCTTGAACAAATAATTGG - Intronic
1187479382 X:19641108-19641130 TGGCGTCTTGAACAAATAATTGG - Intronic
1187644699 X:21334612-21334634 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1188079874 X:25825915-25825937 TAGCATCATTACCAAAGAATTGG - Intergenic
1188213955 X:27455211-27455233 TGGCATGTTAACCAAGGAATGGG - Intergenic
1188256337 X:27965805-27965827 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1188282650 X:28289344-28289366 TGGCATTTTGAATAAGGAACTGG + Intergenic
1188446265 X:30256121-30256143 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1188518242 X:31010525-31010547 TGGCATCTTGAACAAAGAATTGG + Intergenic
1188680823 X:33002254-33002276 TGGTGTCTTGATCAAAGAATTGG + Intronic
1188752951 X:33926165-33926187 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1188822794 X:34796351-34796373 GGGGATCTTGAAAAAAGAACAGG + Intergenic
1188823531 X:34802717-34802739 GGGCATCTTGAAAAAAGAACAGG + Intergenic
1188849488 X:35114445-35114467 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1188970382 X:36607997-36608019 TGGCATCATGTATAAAGAATTGG - Intergenic
1189069484 X:37848494-37848516 TGGCTCTTTGAACAAAGAATTGG + Intronic
1189290844 X:39884891-39884913 TGGTGTTTTGAACAAAGAATTGG + Intergenic
1189415817 X:40812460-40812482 TGGCATTTTGAACAAAGAATTGG + Intergenic
1189416350 X:40817425-40817447 TGGCGTTTTTAACAAAGAATTGG + Intergenic
1189432482 X:40959902-40959924 TGGCATTTTAAACAAAGAATTGG - Intergenic
1189440716 X:41033187-41033209 TAGCGTTTTGAACAAATAATTGG + Intergenic
1189509492 X:41647956-41647978 AGGCACCTTGAAAAAAGAACAGG + Intronic
1189557638 X:42162046-42162068 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1189761760 X:44329026-44329048 TGGCATCGTGAACAAAGAATTGG - Intronic
1189796475 X:44650615-44650637 TGGCTTCTCGAACAAAGAATTGG + Intergenic
1189815161 X:44817429-44817451 TGGTGTCCTGAACAAAGAATTGG + Intergenic
1189867294 X:45344266-45344288 TGGCATCTTGAACAAAGAATTGG - Intergenic
1189973806 X:46443041-46443063 TGTCAGCCTGAAAAAAGAATGGG + Intergenic
1190001962 X:46697714-46697736 GGGCACCTTGAAAAAAGAACAGG + Intronic
1190152840 X:47962465-47962487 GGGCACCTTGAAAAAAGAACAGG - Intronic
1190166569 X:48078086-48078108 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1190185878 X:48233809-48233831 GGGCACCTTGAAAAAAGAACAGG + Intronic
1190408446 X:50110986-50111008 TGGCGTCTTGAGCAAAGAATTGG + Intergenic
1190408913 X:50115206-50115228 TGTTGTTTTGAACAAAGAATTGG - Intergenic
1190616257 X:52236270-52236292 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1190651336 X:52571681-52571703 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1190766336 X:53478799-53478821 TGGCATTTTGAAGAAAGAATTGG + Intergenic
1190766342 X:53478855-53478877 TGGCGTTTTGCACAAAGAATTGG + Intergenic
1190957684 X:55211433-55211455 TGGCATTTTGAAAAAAGAATTGG - Intronic
1191063660 X:56324822-56324844 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1191126010 X:56954589-56954611 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1191148360 X:57192999-57193021 GGGCACCTTGAAGAAAGAACAGG + Intergenic
1191191753 X:57675326-57675348 TGGTGTTTTGAACAAAGAATTGG + Intergenic
1191201926 X:57792362-57792384 TGGCGTTTTGAACAAAGAATTGG - Intergenic
1191722033 X:64239157-64239179 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1191803146 X:65103390-65103412 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1191980818 X:66923707-66923729 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1192059763 X:67812087-67812109 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1192077601 X:68016391-68016413 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1192114856 X:68400291-68400313 TGGCGTTTTGGACAAAGAATTGG - Intronic
1192119253 X:68439380-68439402 TGGCATTTTGAGCAAAGAATTGG - Intergenic
1192121573 X:68461166-68461188 TGGCGTTTTGAACAAATAATTGG + Intergenic
1192479379 X:71471609-71471631 TGGCATTTGGAACAAAGAATTGG + Intronic
1192565992 X:72164091-72164113 CGGCGTTTTGAACAAAGAATTGG - Intergenic
1192566546 X:72168886-72168908 TGGCATTTTGAACAAAGAATTGG + Intergenic
1192672402 X:73159330-73159352 TGGCATCTTGAACAAAGAATTGG + Intergenic
1192752262 X:74005456-74005478 AGGCACCTTGAAAAAAGAACAGG - Intergenic
1192983438 X:76371251-76371273 TGGCATCTTGAACGAAGTATTGG + Intergenic
1192984904 X:76387230-76387252 TGGCATCTCGAACAAAGAACTGG + Intergenic
1192991003 X:76456075-76456097 TGGCATCTCAAACAAAGAATTGG - Intergenic
1193117318 X:77787921-77787943 TGGCGTTTCGAACAAGGAATTGG + Intergenic
1193135140 X:77962490-77962512 TGGCGTCTTAAACAAAGAATTGG - Intronic
1193148651 X:78103267-78103289 TAGCGTCTTGAACTAAGAACTGG - Intronic
1193254498 X:79331271-79331293 TGGCGTCTCAAACAAACAATTGG + Intergenic
1193301684 X:79896649-79896671 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1193507773 X:82364132-82364154 TGGCATGTTGAACAAAGAATTGG + Intergenic
1193508383 X:82370777-82370799 TGGCATCTTGAACAAAGAATTGG + Intergenic
1193594708 X:83432328-83432350 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1193680668 X:84515374-84515396 GAGCATCTTGAAAAAAGAACAGG - Intergenic
1193947492 X:87755964-87755986 TGGTGTTTTGAACAAAGAATTGG + Intergenic
1193988048 X:88270609-88270631 TGGCATCTTGAACAAAGAATTGG - Intergenic
1194090237 X:89576149-89576171 TGGCGTCTTGAACAAAGAATTGG - Intergenic
1194135650 X:90137845-90137867 TGATGTCTTGAACAAAAAATTGG - Intergenic
1194350199 X:92817852-92817874 TGGCACCTTGAATAAAGAATTGG + Intergenic
1194351772 X:92830054-92830076 TGGCATATTGAACAAAGAATCGG + Intergenic
1194491246 X:94552236-94552258 TGGCATGTTGAAAAAAGAATTGG - Intergenic
1194535887 X:95105590-95105612 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1194800741 X:98269433-98269455 GGGCACCTTGAAAAAAGAAAAGG + Intergenic
1194923234 X:99793682-99793704 GGGCACCTTGAAAAAAGAATAGG + Intergenic
1195143385 X:101987044-101987066 TGGCATCTTGAACAAGCAATTGG - Intergenic
1195202190 X:102562819-102562841 TAGCATCCTGAATAAAGAAATGG - Intergenic
1195256702 X:103097727-103097749 TGGCGTCATGAACAAGGAATTGG - Intergenic
1195640433 X:107168924-107168946 AGTTATCTGGAACAAAGAATGGG - Intronic
1195899361 X:109781348-109781370 TGGTGTCTTGAACAAAAAATTGG - Intergenic
1196072607 X:111543142-111543164 TGGTGTTTTGAACAAAGAACTGG + Intergenic
1196392147 X:115218887-115218909 TGGTGTTTTGAACAAAGAATTGG - Intronic
1196400630 X:115312434-115312456 TGGTGTCTTGAACAAAGAATTGG + Intergenic
1196401250 X:115318732-115318754 TGGCGTCTTGAACAAAGAACTGG + Intergenic
1196420239 X:115513720-115513742 TGGGCTCTTGAACAAAGAATTGG - Intergenic
1196464326 X:115957824-115957846 TAGCATCTTGAAAAATGAATTGG - Intergenic
1196542356 X:116924539-116924561 TAGCATCTTAAACAAAGAATTGG + Intergenic
1196713491 X:118787847-118787869 GGGCACCTTGAAAAAAGAAAAGG - Intronic
1196759441 X:119188135-119188157 TGGCATTTTGAACAAAAAATTGG - Intergenic
1196774910 X:119329468-119329490 TGGCATTTTGAACAAAGAATTGG + Intergenic
1196778761 X:119363205-119363227 TGGCATTTTGAACAAAGAATTGG + Intergenic
1196778775 X:119363331-119363353 TGGCATTTTGAACAAAGAATTGG + Intergenic
1196779697 X:119372774-119372796 TGGCATTTTGAACAAAGAATTGG + Intergenic
1196844302 X:119886429-119886451 TGGCGTTTTGAACAAAGAATTGG - Intergenic
1196854544 X:119970483-119970505 TGGCGTTTTGAACAAAGAATTGG + Intergenic
1196858055 X:120001716-120001738 TGGCGTTTTGAACAAAGAATTGG + Intergenic
1196872759 X:120128251-120128273 TGGCGTTTTGAACAAAGAATTGG + Intergenic
1196938194 X:120750431-120750453 TGGCCTCTGGGACAAAGAGTGGG - Intergenic
1196967772 X:121077081-121077103 TGGCATCTTGAACAAAGAATTGG + Intergenic
1196973311 X:121132749-121132771 TGGCATCTGGAACAAAGAATTGG + Intergenic
1196974392 X:121142356-121142378 TGGCATTTTGAACAAACAATTGG + Intergenic
1197071630 X:122305966-122305988 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1197086467 X:122482542-122482564 GGGCATCTTGAAAAAAGAACAGG + Intergenic
1197093527 X:122567389-122567411 TGGTCTCTTGAAGAAAGAATTGG - Intergenic
1197113174 X:122800412-122800434 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1197229619 X:123990026-123990048 TGGCATTTTGAACGAAGAATTGG + Intronic
1197242942 X:124139123-124139145 TGGCATCTTGAACAAAGAAATGG + Intronic
1197364763 X:125549772-125549794 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1197446400 X:126555372-126555394 TGGCATTCTGAACAAATAATTGG - Intergenic
1197474020 X:126897460-126897482 GGGCAACTTGAAAAAAGAACAGG - Intergenic
1197495008 X:127168838-127168860 TGGATTCTTCAACAAAGAAGAGG + Intergenic
1197549138 X:127866798-127866820 GGGCATCCTGAAAAAAGAAAAGG + Intergenic
1197794867 X:130287824-130287846 TGTCGTTTTGAACAAAGAATTGG - Intergenic
1198092529 X:133345850-133345872 TGGTGTTTTGAACAAATAATTGG + Intronic
1198094637 X:133367174-133367196 TGGCGTTTTGAACAAAGGATTGG - Intronic
1198102496 X:133434186-133434208 TGGCGTTTTGAACAAAGAAGTGG + Intergenic
1198294522 X:135273037-135273059 TGGCATCTTGAATGAAGAATTGG - Intronic
1198383683 X:136107440-136107462 TGGTGTTTTGAACAAATAATTGG - Intergenic
1198385422 X:136124510-136124532 TGGCATTTTGAACAAAGAATTGG - Intergenic
1198558084 X:137817535-137817557 TGGCATGTTTAAGAGAGAATGGG - Intergenic
1198628520 X:138607095-138607117 TGGCATTTTGAACAAAGAATTGG - Intergenic
1198912411 X:141629342-141629364 GGGCACCTTGAAAAAAGAACAGG + Intronic
1198980801 X:142392846-142392868 TGGCACCAAGAACAAACAATGGG - Intergenic
1199063776 X:143389919-143389941 GGGCAACTAGAACAAAGAAGAGG + Intergenic
1199113704 X:143964438-143964460 TGGCATTTTGAACAAATAATTGG + Intergenic
1199321235 X:146441914-146441936 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1199337689 X:146639874-146639896 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1199357730 X:146881186-146881208 TGGCATCTTGAACAAAGAATCGG - Intergenic
1199398249 X:147366235-147366257 TGGCATTTTGAAGAAAGAATTGG + Intergenic
1199477040 X:148257250-148257272 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1199529556 X:148831150-148831172 GGGCACCTTGAAAAAAGAACAGG - Intronic
1199536496 X:148908114-148908136 GGGCACCTTGAAAAAAGAACAGG - Intronic
1199561597 X:149169326-149169348 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1199884164 X:152002655-152002677 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1200442888 Y:3232202-3232224 TGGCGTCTTGAACAAAGAATTGG - Intergenic
1200481416 Y:3707926-3707948 TGATGTCTTGAACAAAAAATTGG - Intergenic
1200658519 Y:5934494-5934516 TGGCACCTTGAATAAAGAATTGG + Intergenic
1200660086 Y:5946747-5946769 TGGCATATTGAACAAAGGATCGG + Intergenic
1200761754 Y:7045157-7045179 TGGTGTCTTGAACAAAGAATTGG + Intronic
1200950431 Y:8893577-8893599 GGGCACCTTGAAAAAAGAACAGG + Intergenic
1200976995 Y:9222818-9222840 TGGCATTTTCAACCAAGAGTGGG - Intergenic
1201343055 Y:12954473-12954495 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1201354695 Y:13084375-13084397 TGGCATTTAGAACAAAGAACCGG + Intergenic
1201355578 Y:13093894-13093916 TGGCATTTTGAGCAAAGAAGTGG + Intergenic
1201478524 Y:14411013-14411035 GGGCACCTTGAAAAAAGAACAGG - Intergenic
1201517430 Y:14833223-14833245 GGGCACCTTGAAAAAAGAACAGG - Intronic
1201644488 Y:16214209-16214231 TGTAATCTTAAACAAAGAAAAGG + Intergenic
1201658327 Y:16371112-16371134 TGTAATCTTAAACAAAGAAAAGG - Intergenic
1202044512 Y:20725086-20725108 TGGCATCTTGAACAAAGAACTGG + Intergenic
1202083424 Y:21108884-21108906 TGGTGTCATGAGCAAAGAATTGG - Intergenic
1202135484 Y:21656647-21656669 GGGCATCCTGAAGAAAGAACAGG + Intergenic
1202167867 Y:22011721-22011743 AGCCCTCTTGAACAAAGAAATGG + Intergenic
1202223494 Y:22574647-22574669 AGCCCTCTTGAACAAAGAAATGG - Intergenic
1202247484 Y:22834570-22834592 TGGCACCTTGAAAAAAGAACAGG - Intergenic
1202277552 Y:23139876-23139898 TGGCATCTTAAAAAAAAAATAGG + Exonic
1202277877 Y:23144642-23144664 TGGCATCTTGAAAAAAAAAGGGG + Intronic
1202287326 Y:23264125-23264147 TGGCATCTTGAAAAAAAAAGGGG - Intronic
1202288476 Y:23280812-23280834 TGGCATCTTAAAAAAAAAATAGG - Exonic
1202319622 Y:23621014-23621036 AGCCCTCTTGAACAAAGAAATGG + Intergenic
1202340347 Y:23857981-23858003 AGGCACCTTGAAAAAAGAACAGG + Intergenic
1202346331 Y:23931877-23931899 GGGCACCTTGAAAAAAGAAGAGG - Intergenic
1202400472 Y:24468318-24468340 TGGCACCTTGAAAAAAGAACAGG - Intergenic
1202430544 Y:24773599-24773621 TGGCATCTTAAAAAAAAAATAGG + Exonic
1202430703 Y:24775981-24776003 TGGCATCTTGAAAAAAAAAGGGG + Intronic
1202439266 Y:24882182-24882204 TGGCATCTTGAAAAAAAAAGGGG - Intronic
1202440248 Y:24896488-24896510 TGGCATCTTAAAAAAAAAATAGG - Exonic
1202470308 Y:25201768-25201790 TGGCACCTTGAAAAAAGAACAGG + Intergenic
1202524440 Y:25738213-25738235 GGGCACCTTGAAAAAAGAAGAGG + Intergenic
1202530419 Y:25812101-25812123 AGGCACCTTGAAAAAAGAACAGG - Intergenic
1202551147 Y:26049043-26049065 AGCCCTCTTGAACAAAGAAATGG - Intergenic