ID: 980302777

View in Genome Browser
Species Human (GRCh38)
Location 4:131015082-131015104
Sequence GGCATCTTGAACAAAGAATC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980302768_980302777 30 Left 980302768 4:131015029-131015051 CCTCCTGGCTGGCTCGTCAAAAT No data
Right 980302777 4:131015082-131015104 GGCATCTTGAACAAAGAATCGGG No data
980302769_980302777 27 Left 980302769 4:131015032-131015054 CCTGGCTGGCTCGTCAAAATATG No data
Right 980302777 4:131015082-131015104 GGCATCTTGAACAAAGAATCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980302777 Original CRISPR GGCATCTTGAACAAAGAATC GGG Intergenic
No off target data available for this crispr