ID: 980310760

View in Genome Browser
Species Human (GRCh38)
Location 4:131126312-131126334
Sequence GACTCTGGGCCTGTGGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980310749_980310760 9 Left 980310749 4:131126280-131126302 CCCAGCACATGAAACCCATTTTT No data
Right 980310760 4:131126312-131126334 GACTCTGGGCCTGTGGTGGCAGG No data
980310752_980310760 -5 Left 980310752 4:131126294-131126316 CCCATTTTTTCCTCCTAGGACTC No data
Right 980310760 4:131126312-131126334 GACTCTGGGCCTGTGGTGGCAGG No data
980310750_980310760 8 Left 980310750 4:131126281-131126303 CCAGCACATGAAACCCATTTTTT No data
Right 980310760 4:131126312-131126334 GACTCTGGGCCTGTGGTGGCAGG No data
980310748_980310760 15 Left 980310748 4:131126274-131126296 CCTGGGCCCAGCACATGAAACCC No data
Right 980310760 4:131126312-131126334 GACTCTGGGCCTGTGGTGGCAGG No data
980310753_980310760 -6 Left 980310753 4:131126295-131126317 CCATTTTTTCCTCCTAGGACTCT No data
Right 980310760 4:131126312-131126334 GACTCTGGGCCTGTGGTGGCAGG No data
980310747_980310760 16 Left 980310747 4:131126273-131126295 CCCTGGGCCCAGCACATGAAACC No data
Right 980310760 4:131126312-131126334 GACTCTGGGCCTGTGGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980310760 Original CRISPR GACTCTGGGCCTGTGGTGGC AGG Intergenic
No off target data available for this crispr