ID: 980310838

View in Genome Browser
Species Human (GRCh38)
Location 4:131127091-131127113
Sequence CCTCTTATATGGATGGTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980310831_980310838 14 Left 980310831 4:131127054-131127076 CCCACAATCATGGAGGAAAGCAA No data
Right 980310838 4:131127091-131127113 CCTCTTATATGGATGGTAGAAGG No data
980310830_980310838 15 Left 980310830 4:131127053-131127075 CCCCACAATCATGGAGGAAAGCA No data
Right 980310838 4:131127091-131127113 CCTCTTATATGGATGGTAGAAGG No data
980310832_980310838 13 Left 980310832 4:131127055-131127077 CCACAATCATGGAGGAAAGCAAG No data
Right 980310838 4:131127091-131127113 CCTCTTATATGGATGGTAGAAGG No data
980310827_980310838 29 Left 980310827 4:131127039-131127061 CCTGGCTTGGGAAACCCCACAAT No data
Right 980310838 4:131127091-131127113 CCTCTTATATGGATGGTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980310838 Original CRISPR CCTCTTATATGGATGGTAGA AGG Intergenic
No off target data available for this crispr