ID: 980338567

View in Genome Browser
Species Human (GRCh38)
Location 4:131509609-131509631
Sequence CTCTTCAGTGCTTTGCAATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980338562_980338567 7 Left 980338562 4:131509579-131509601 CCCTTTTCTAAAGGCTAAATGTT No data
Right 980338567 4:131509609-131509631 CTCTTCAGTGCTTTGCAATAGGG No data
980338563_980338567 6 Left 980338563 4:131509580-131509602 CCTTTTCTAAAGGCTAAATGTTG No data
Right 980338567 4:131509609-131509631 CTCTTCAGTGCTTTGCAATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980338567 Original CRISPR CTCTTCAGTGCTTTGCAATA GGG Intergenic
No off target data available for this crispr