ID: 980341201

View in Genome Browser
Species Human (GRCh38)
Location 4:131549393-131549415
Sequence GAGGGATGTCAAGAAGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980341197_980341201 -4 Left 980341197 4:131549374-131549396 CCACCTACATGGGAACAGGGAGG No data
Right 980341201 4:131549393-131549415 GAGGGATGTCAAGAAGCTGCAGG No data
980341200_980341201 -7 Left 980341200 4:131549377-131549399 CCTACATGGGAACAGGGAGGGAT No data
Right 980341201 4:131549393-131549415 GAGGGATGTCAAGAAGCTGCAGG No data
980341191_980341201 28 Left 980341191 4:131549342-131549364 CCAAAGAAGGTTCAGTGAAGACA No data
Right 980341201 4:131549393-131549415 GAGGGATGTCAAGAAGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980341201 Original CRISPR GAGGGATGTCAAGAAGCTGC AGG Intergenic
No off target data available for this crispr