ID: 980341952

View in Genome Browser
Species Human (GRCh38)
Location 4:131561958-131561980
Sequence TTTGGCCAAATGTGCATTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980341952_980341955 -3 Left 980341952 4:131561958-131561980 CCCAAAATGCACATTTGGCCAAA No data
Right 980341955 4:131561978-131562000 AAAAATAATTTGTTAAATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980341952 Original CRISPR TTTGGCCAAATGTGCATTTT GGG (reversed) Intergenic
No off target data available for this crispr