ID: 980341955

View in Genome Browser
Species Human (GRCh38)
Location 4:131561978-131562000
Sequence AAAAATAATTTGTTAAATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980341952_980341955 -3 Left 980341952 4:131561958-131561980 CCCAAAATGCACATTTGGCCAAA No data
Right 980341955 4:131561978-131562000 AAAAATAATTTGTTAAATAAAGG No data
980341953_980341955 -4 Left 980341953 4:131561959-131561981 CCAAAATGCACATTTGGCCAAAA No data
Right 980341955 4:131561978-131562000 AAAAATAATTTGTTAAATAAAGG No data
980341950_980341955 -1 Left 980341950 4:131561956-131561978 CCCCCAAAATGCACATTTGGCCA No data
Right 980341955 4:131561978-131562000 AAAAATAATTTGTTAAATAAAGG No data
980341951_980341955 -2 Left 980341951 4:131561957-131561979 CCCCAAAATGCACATTTGGCCAA No data
Right 980341955 4:131561978-131562000 AAAAATAATTTGTTAAATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980341955 Original CRISPR AAAAATAATTTGTTAAATAA AGG Intergenic
No off target data available for this crispr