ID: 980347698

View in Genome Browser
Species Human (GRCh38)
Location 4:131643813-131643835
Sequence ACTGGAAGACTACAGAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980347698_980347704 28 Left 980347698 4:131643813-131643835 CCAGTTTTCTGTAGTCTTCCAGT No data
Right 980347704 4:131643864-131643886 TTTCACAACTGCCTCCTCATGGG No data
980347698_980347703 27 Left 980347698 4:131643813-131643835 CCAGTTTTCTGTAGTCTTCCAGT No data
Right 980347703 4:131643863-131643885 TTTTCACAACTGCCTCCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980347698 Original CRISPR ACTGGAAGACTACAGAAAAC TGG (reversed) Intergenic