ID: 980347699

View in Genome Browser
Species Human (GRCh38)
Location 4:131643831-131643853
Sequence GACTGAACACACTGAGGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980347699_980347705 19 Left 980347699 4:131643831-131643853 CCAGTTCCTCAGTGTGTTCAGTC No data
Right 980347705 4:131643873-131643895 TGCCTCCTCATGGGACATATAGG No data
980347699_980347704 10 Left 980347699 4:131643831-131643853 CCAGTTCCTCAGTGTGTTCAGTC No data
Right 980347704 4:131643864-131643886 TTTCACAACTGCCTCCTCATGGG No data
980347699_980347703 9 Left 980347699 4:131643831-131643853 CCAGTTCCTCAGTGTGTTCAGTC No data
Right 980347703 4:131643863-131643885 TTTTCACAACTGCCTCCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980347699 Original CRISPR GACTGAACACACTGAGGAAC TGG (reversed) Intergenic