ID: 980347700

View in Genome Browser
Species Human (GRCh38)
Location 4:131643837-131643859
Sequence TATCTGGACTGAACACACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980347700_980347703 3 Left 980347700 4:131643837-131643859 CCTCAGTGTGTTCAGTCCAGATA No data
Right 980347703 4:131643863-131643885 TTTTCACAACTGCCTCCTCATGG No data
980347700_980347705 13 Left 980347700 4:131643837-131643859 CCTCAGTGTGTTCAGTCCAGATA No data
Right 980347705 4:131643873-131643895 TGCCTCCTCATGGGACATATAGG No data
980347700_980347704 4 Left 980347700 4:131643837-131643859 CCTCAGTGTGTTCAGTCCAGATA No data
Right 980347704 4:131643864-131643886 TTTCACAACTGCCTCCTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980347700 Original CRISPR TATCTGGACTGAACACACTG AGG (reversed) Intergenic