ID: 980347703

View in Genome Browser
Species Human (GRCh38)
Location 4:131643863-131643885
Sequence TTTTCACAACTGCCTCCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980347698_980347703 27 Left 980347698 4:131643813-131643835 CCAGTTTTCTGTAGTCTTCCAGT No data
Right 980347703 4:131643863-131643885 TTTTCACAACTGCCTCCTCATGG No data
980347700_980347703 3 Left 980347700 4:131643837-131643859 CCTCAGTGTGTTCAGTCCAGATA No data
Right 980347703 4:131643863-131643885 TTTTCACAACTGCCTCCTCATGG No data
980347699_980347703 9 Left 980347699 4:131643831-131643853 CCAGTTCCTCAGTGTGTTCAGTC No data
Right 980347703 4:131643863-131643885 TTTTCACAACTGCCTCCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980347703 Original CRISPR TTTTCACAACTGCCTCCTCA TGG Intergenic