ID: 980347705

View in Genome Browser
Species Human (GRCh38)
Location 4:131643873-131643895
Sequence TGCCTCCTCATGGGACATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980347700_980347705 13 Left 980347700 4:131643837-131643859 CCTCAGTGTGTTCAGTCCAGATA No data
Right 980347705 4:131643873-131643895 TGCCTCCTCATGGGACATATAGG No data
980347701_980347705 -3 Left 980347701 4:131643853-131643875 CCAGATACCTTTTTCACAACTGC No data
Right 980347705 4:131643873-131643895 TGCCTCCTCATGGGACATATAGG No data
980347702_980347705 -10 Left 980347702 4:131643860-131643882 CCTTTTTCACAACTGCCTCCTCA No data
Right 980347705 4:131643873-131643895 TGCCTCCTCATGGGACATATAGG No data
980347699_980347705 19 Left 980347699 4:131643831-131643853 CCAGTTCCTCAGTGTGTTCAGTC No data
Right 980347705 4:131643873-131643895 TGCCTCCTCATGGGACATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980347705 Original CRISPR TGCCTCCTCATGGGACATAT AGG Intergenic
No off target data available for this crispr