ID: 980363845

View in Genome Browser
Species Human (GRCh38)
Location 4:131773294-131773316
Sequence ACAAGCTCATTACCGGTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 39}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980363845_980363849 23 Left 980363845 4:131773294-131773316 CCCAGCACCGGTAATGAGCTTGT 0: 1
1: 0
2: 2
3: 8
4: 39
Right 980363849 4:131773340-131773362 TATCACTTTAACGCAGATGGAGG No data
980363845_980363848 20 Left 980363845 4:131773294-131773316 CCCAGCACCGGTAATGAGCTTGT 0: 1
1: 0
2: 2
3: 8
4: 39
Right 980363848 4:131773337-131773359 CTTTATCACTTTAACGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980363845 Original CRISPR ACAAGCTCATTACCGGTGCT GGG (reversed) Intergenic
1063032072 10:2245347-2245369 ACACTCTCATTACAGGTGGTGGG - Intergenic
1065853851 10:29814034-29814056 GCAAGCTCATTTCCTCTGCTTGG + Intergenic
1087515432 11:99154158-99154180 ACAAGCACATTTCCTGTGGTGGG + Intronic
1106510628 13:30409400-30409422 ACAGGCTCACTACCCTTGCTGGG - Intergenic
1111310385 13:86476673-86476695 ACAAGCTCGTTACCAGTCCATGG + Intergenic
1114242383 14:20880393-20880415 AGTAGCTCATTACTGGAGCTGGG - Intergenic
1114249301 14:20944297-20944319 AGTAGCTCATTACTGGAGCTGGG - Intergenic
1119942939 14:78660376-78660398 ACATGCTCACTAACGGAGCTGGG - Intronic
1120164330 14:81179932-81179954 ACATGCTAATTACCGGTGGCAGG + Exonic
1121838073 14:97109656-97109678 ACAAGCTGGTTATCAGTGCTGGG + Intergenic
1122237722 14:100341819-100341841 ACCAGCTCATAACCCCTGCTTGG + Intronic
1131522803 15:93128955-93128977 GCAAGCTCAGTAACGTTGCTAGG - Intergenic
1167285764 19:48598164-48598186 ACAACCTCATTAAGGGTGCTGGG + Intronic
926016698 2:9459197-9459219 ACAGGATAATTACTGGTGCTGGG - Intronic
936332700 2:111562250-111562272 ACACTCTCATTGCAGGTGCTTGG - Intergenic
943780445 2:191817575-191817597 ATAAGCTCTTTCCCGGTGCCAGG + Intergenic
1172618454 20:36305557-36305579 ATGAGCTCTTTACCGGTGCCTGG - Intergenic
1176691262 21:9913108-9913130 ACAAGCTCATTACCAGTGTTGGG - Intergenic
1177776646 21:25575421-25575443 ACAAGCTCATTCCAGGTGTTAGG - Intergenic
1178032624 21:28545272-28545294 ACAAGCTCATCGCCTGTACTTGG - Intergenic
949937100 3:9124406-9124428 GCTAGCTCAGTGCCGGTGCTTGG + Intronic
950874186 3:16255239-16255261 CCAACCCCATTACCGATGCTCGG + Intergenic
951734252 3:25846781-25846803 TCAAGCTCATTACTGGTGGCTGG + Intergenic
952599281 3:35059750-35059772 AACAGATCATTACCTGTGCTAGG + Intergenic
962986898 3:140544530-140544552 ACAAACTGATTCCTGGTGCTGGG - Intronic
962991964 3:140585934-140585956 GCCAGCTCATTAACAGTGCTGGG - Intergenic
964313444 3:155418550-155418572 ACAAGCACATCTCTGGTGCTAGG + Intronic
965847714 3:172984160-172984182 ACAAGCACATTTCAGGTGCTCGG + Intronic
980363845 4:131773294-131773316 ACAAGCTCATTACCGGTGCTGGG - Intergenic
983935034 4:173496363-173496385 AGGAGCTCATTACAGTTGCTAGG + Intergenic
991230449 5:64326971-64326993 TCAATCTCATTACCTGTGATTGG + Intronic
992827134 5:80561535-80561557 ACAAGCTCCTGACATGTGCTGGG + Intronic
994305492 5:98198985-98199007 ACAAGCTCTTCGCCGGTTCTTGG - Intergenic
1005568046 6:27116035-27116057 GCATGGTCATTACCGGTGCTTGG + Intergenic
1018722913 6:166587403-166587425 ACAAGCTCCTCACCCGTCCTTGG + Intronic
1019693634 7:2432357-2432379 CCAGGGTCATTACTGGTGCTCGG + Intronic
1026777030 7:73236805-73236827 ACAACCTCATAACCGGGGCACGG - Intergenic
1027017876 7:74790175-74790197 ACAACCTCATAACCGGGGCACGG - Intergenic
1027070147 7:75155754-75155776 ACAACCTCATAACCGGGGCACGG + Intergenic
1028918089 7:96281835-96281857 ACAAGCTCATCACCACGGCTGGG + Intronic
1029087375 7:98021998-98022020 ACAAGGTCATTACCTGCGCAGGG - Intergenic
1030921740 7:115397962-115397984 AAAAGCACATTTCCTGTGCTTGG + Intergenic
1038802601 8:30762785-30762807 ACATGATCATTAACTGTGCTGGG - Intronic
1041533678 8:58901356-58901378 ACAAGCTCCTTCCAGTTGCTAGG + Intronic
1053628194 9:39899178-39899200 ACAAACTCATTACCAGTGTTGGG - Intergenic
1053777862 9:41567149-41567171 ACAAGCTCATTACCAGTGTTGGG + Intergenic
1054215693 9:62351523-62351545 ACAAACTCATTACCAGTGTTGGG + Intergenic
1054364188 9:64315274-64315296 ACAAACTCATTACCAGTGTTGGG - Intergenic
1054671789 9:67803827-67803849 ACAAACTCATTACCAGTGTTGGG - Intergenic
1055980223 9:81993588-81993610 ACAAGCTCATTCCCCATCCTCGG + Exonic