ID: 980363846

View in Genome Browser
Species Human (GRCh38)
Location 4:131773295-131773317
Sequence TACAAGCTCATTACCGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 44}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980363846_980363848 19 Left 980363846 4:131773295-131773317 CCAGCACCGGTAATGAGCTTGTA 0: 1
1: 0
2: 2
3: 4
4: 44
Right 980363848 4:131773337-131773359 CTTTATCACTTTAACGCAGATGG No data
980363846_980363849 22 Left 980363846 4:131773295-131773317 CCAGCACCGGTAATGAGCTTGTA 0: 1
1: 0
2: 2
3: 4
4: 44
Right 980363849 4:131773340-131773362 TATCACTTTAACGCAGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980363846 Original CRISPR TACAAGCTCATTACCGGTGC TGG (reversed) Intergenic
910525687 1:88175428-88175450 TACAGGCTCTTTCCAGGTGCTGG + Intergenic
1064600002 10:16984175-16984197 TGCTAGCTCATTTCCAGTGCTGG + Exonic
1067794107 10:49308249-49308271 TACAACCACATTACATGTGCAGG - Intronic
1070432361 10:76353734-76353756 TGAAAGCTCATTCCAGGTGCTGG + Intronic
1080020732 11:27557070-27557092 TACAAGGTCATTTCCTGTGGGGG - Intergenic
1081133361 11:39407486-39407508 TTTAAGCTCCTTACAGGTGCTGG - Intergenic
1087071983 11:94090221-94090243 TACAAGCTGAAGACTGGTGCTGG + Intronic
1087515431 11:99154157-99154179 TACAAGCACATTTCCTGTGGTGG + Intronic
1101177918 12:102175658-102175680 AAAAAGCTCATTACCCGAGCAGG - Exonic
1103260521 12:119584665-119584687 TCCAGGCTCTTTACTGGTGCTGG + Intergenic
1106510629 13:30409401-30409423 TACAGGCTCACTACCCTTGCTGG - Intergenic
1111932228 13:94524225-94524247 AACAAGCTCCTGACAGGTGCAGG + Intergenic
1120668179 14:87332246-87332268 TTCATGCTCATTACTGATGCTGG + Intergenic
1120712181 14:87804462-87804484 TCCATTCTAATTACCGGTGCAGG + Intergenic
1121188803 14:92004385-92004407 TCCAGCCTCATTACCAGTGCTGG + Exonic
1130425776 15:83797712-83797734 TTCACCCTCATTACCAGTGCAGG - Intronic
1135746304 16:25019742-25019764 TCCAATCTCATGACCAGTGCTGG - Intergenic
1137796419 16:51224012-51224034 CACAAGCTCTTTACCTCTGCTGG + Intergenic
1140713639 16:77701945-77701967 TCCAAGCTTATTCCAGGTGCTGG - Intergenic
1146753448 17:35404010-35404032 TCCATTCTAATTACCGGTGCAGG - Intergenic
1146905299 17:36614189-36614211 TCCCAGCTCATTACTGGTGGGGG + Intergenic
1158831976 18:61289688-61289710 TACAAGCCCTTTCCCAGTGCTGG - Intergenic
1162284879 19:9730652-9730674 TCCATTCTAATTACCGGTGCAGG - Intergenic
1163494496 19:17638185-17638207 TATAAGCTCCTTACAGGTGGTGG + Intronic
1167285763 19:48598163-48598185 CACAACCTCATTAAGGGTGCTGG + Intronic
928951104 2:36813618-36813640 TCCAACCTCATTTCCAGTGCAGG - Intronic
939292701 2:140216246-140216268 TCCAAGCTCATTCCGGGTGATGG - Intergenic
1176691263 21:9913109-9913131 TACAAGCTCATTACCAGTGTTGG - Intergenic
951165603 3:19482137-19482159 TCCATTCTAATTACCGGTGCAGG - Intronic
955523746 3:59800226-59800248 TAAAAGCTGATTACTGGTTCTGG + Intronic
969896241 4:10307631-10307653 TACAAGCTCATTACTCTTGAAGG + Intergenic
980363846 4:131773295-131773317 TACAAGCTCATTACCGGTGCTGG - Intergenic
981567253 4:146114234-146114256 TCCAAGGTCATTACAGCTGCAGG - Intergenic
985428734 4:189857518-189857540 TAAAAGATCATTAGCGTTGCTGG - Intergenic
992827133 5:80561534-80561556 TACAAGCTCCTGACATGTGCTGG + Intronic
999808547 5:155106769-155106791 TGGAAGCTCATTACACGTGCAGG - Intergenic
1018780685 6:167062163-167062185 AACAAGCTCAGCACGGGTGCAGG + Intergenic
1029087376 7:98021999-98022021 GACAAGGTCATTACCTGCGCAGG - Intergenic
1036551131 8:9815925-9815947 GACAAGCTCAGTATCTGTGCTGG - Intergenic
1045174847 8:99711463-99711485 AACAAGCTCATGATCAGTGCTGG + Intronic
1046207414 8:111018944-111018966 TTCAAGCTCTTCACCAGTGCTGG - Intergenic
1053628195 9:39899179-39899201 TACAAACTCATTACCAGTGTTGG - Intergenic
1053777861 9:41567148-41567170 TACAAGCTCATTACCAGTGTTGG + Intergenic
1054215692 9:62351522-62351544 TACAAACTCATTACCAGTGTTGG + Intergenic
1054364189 9:64315275-64315297 TACAAACTCATTACCAGTGTTGG - Intergenic
1054671790 9:67803828-67803850 TACAAACTCATTACCAGTGTTGG - Intergenic
1059097751 9:111436995-111437017 TAAAAGCTCATTCCCGGAGGAGG + Exonic
1061139752 9:128758446-128758468 TAGAATCTCATTACCTGGGCTGG + Intronic
1191155714 X:57270788-57270810 GACAAGCTCAGTATCTGTGCTGG - Intergenic
1191899765 X:66028736-66028758 TACAACCCCATTCCAGGTGCTGG + Intronic
1196039071 X:111182115-111182137 AACAAGCTCATTACTGTGGCTGG - Intronic